ID: 1104816320

View in Genome Browser
Species Human (GRCh38)
Location 12:131647981-131648003
Sequence CGTGCATGGGGGTGAGCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104816320_1104816327 -1 Left 1104816320 12:131647981-131648003 CCCCATGCTCACCCCCATGCACG No data
Right 1104816327 12:131648003-131648025 GCACACACACACACACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104816320 Original CRISPR CGTGCATGGGGGTGAGCATG GGG (reversed) Intergenic