ID: 1104820038

View in Genome Browser
Species Human (GRCh38)
Location 12:131671900-131671922
Sequence CCCCATGACCACCTGAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104820028_1104820038 14 Left 1104820028 12:131671863-131671885 CCAACCCTGGAATCTCAGCTCTA No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data
1104820024_1104820038 21 Left 1104820024 12:131671856-131671878 CCCTGCCCCAACCCTGGAATCTC No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data
1104820030_1104820038 10 Left 1104820030 12:131671867-131671889 CCCTGGAATCTCAGCTCTATGGG No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data
1104820026_1104820038 16 Left 1104820026 12:131671861-131671883 CCCCAACCCTGGAATCTCAGCTC No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data
1104820027_1104820038 15 Left 1104820027 12:131671862-131671884 CCCAACCCTGGAATCTCAGCTCT No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data
1104820032_1104820038 9 Left 1104820032 12:131671868-131671890 CCTGGAATCTCAGCTCTATGGGC No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data
1104820025_1104820038 20 Left 1104820025 12:131671857-131671879 CCTGCCCCAACCCTGGAATCTCA No data
Right 1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104820038 Original CRISPR CCCCATGACCACCTGAGCCC TGG Intergenic
No off target data available for this crispr