ID: 1104825936

View in Genome Browser
Species Human (GRCh38)
Location 12:131709894-131709916
Sequence CTCTTAAAGCTAATTCTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104825930_1104825936 -5 Left 1104825930 12:131709876-131709898 CCCAACAATGTCCCTGATCTCTT 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1104825936 12:131709894-131709916 CTCTTAAAGCTAATTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1104825927_1104825936 26 Left 1104825927 12:131709845-131709867 CCATTCTAGGTGCTGAGGATGCT 0: 1
1: 0
2: 3
3: 35
4: 254
Right 1104825936 12:131709894-131709916 CTCTTAAAGCTAATTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1104825929_1104825936 -4 Left 1104825929 12:131709875-131709897 CCCCAACAATGTCCCTGATCTCT 0: 1
1: 0
2: 0
3: 9
4: 226
Right 1104825936 12:131709894-131709916 CTCTTAAAGCTAATTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 124
1104825931_1104825936 -6 Left 1104825931 12:131709877-131709899 CCAACAATGTCCCTGATCTCTTA 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1104825936 12:131709894-131709916 CTCTTAAAGCTAATTCTGGTGGG 0: 1
1: 0
2: 0
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104825936 Original CRISPR CTCTTAAAGCTAATTCTGGT GGG Intergenic
902327415 1:15710747-15710769 CTTTTAAAACTACTTCTTGTTGG - Intronic
903394592 1:22990096-22990118 CTTTTAAAACTAATTTTGTTAGG - Intergenic
905106026 1:35564106-35564128 CTTTTAAGGCAAAGTCTGGTGGG + Intronic
908442802 1:64171534-64171556 CTTTTGAAGCTGATTCTGGCTGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
910879040 1:91906008-91906030 ATTTTAAAGATAATTCTGGACGG + Intronic
911555004 1:99333146-99333168 GAATTATAGCTAATTCTGGTGGG - Intergenic
912547984 1:110465131-110465153 CTTTGAAACCTAATTCTGGATGG - Intergenic
913100939 1:115564808-115564830 TTCTTAAAGATAATTCAGCTAGG + Intergenic
917451958 1:175154665-175154687 CTCATAAAGCTAATTCTAATGGG + Intergenic
918001328 1:180500394-180500416 CTCTTAAAGCAAATGTTGGCGGG + Intronic
918495288 1:185128270-185128292 CTCTTAAAACTAATTCTTCTAGG + Intronic
918967102 1:191365199-191365221 CTCCTATATCTACTTCTGGTGGG + Intergenic
919157140 1:193780202-193780224 CTCTGAAAGCTGAAACTGGTTGG + Intergenic
919674424 1:200367294-200367316 TTCATAAAACAAATTCTGGTAGG - Intergenic
922443769 1:225679048-225679070 CTGTTAAAGGTTTTTCTGGTAGG + Intergenic
924304142 1:242670104-242670126 ATCTAAAAGCTAGTTCTGTTTGG + Intergenic
1062823060 10:549122-549144 CTCTTAAAGCTACTATTTGTAGG - Intronic
1064592769 10:16911509-16911531 CTCTTGCAGCTACTGCTGGTGGG - Intronic
1067313995 10:45143967-45143989 CTCTTGCAGCTACTGCTGGTGGG + Intergenic
1068711541 10:60140665-60140687 CTTTTAAAGCTCCTTCTGATTGG + Intronic
1071808656 10:89153281-89153303 CTGTTAAATCTAATCCTGTTGGG + Intergenic
1073684130 10:105734086-105734108 CTCTCAGAACTTATTCTGGTAGG - Intergenic
1075803291 10:125166577-125166599 ACCATAAAGCTAATTCTGGTTGG - Intergenic
1079336714 11:19576688-19576710 CTCTTAAACCTAATTCTGTATGG + Intronic
1084075847 11:66775527-66775549 CTCTTAAAGCTTCTCCTGGAAGG - Intronic
1085354903 11:75827312-75827334 ATGTTAAAACTAATTCTGGGCGG + Intronic
1086288378 11:85275159-85275181 TTCTTAAAGATAGTTCTGTTGGG - Intronic
1087544711 11:99570093-99570115 CTCTTGAAGCAAATTCTTGCAGG - Intronic
1089120394 11:116130397-116130419 CTCTGAAAACTAATTTTGTTTGG + Intergenic
1093243243 12:16703600-16703622 CTCTTAAAGCTAAGGAGGGTAGG - Intergenic
1094104659 12:26797985-26798007 CTTTTAAAGACAATTCTGCTGGG - Intronic
1095162118 12:38931134-38931156 CAGTCTAAGCTAATTCTGGTTGG + Intergenic
1096370094 12:51062211-51062233 CTCATAAAGCCTTTTCTGGTGGG - Exonic
1096751923 12:53765195-53765217 CTCTTAAACCTCATTCTAGCTGG - Intergenic
1099553744 12:84082103-84082125 CTGAGAAAGCTAATTCTGGATGG + Intergenic
1102671547 12:114623544-114623566 CTCTTAAAGCTAGTTTGAGTTGG - Intergenic
1104427623 12:128691188-128691210 CACATAAAGCTAATTCTTGCTGG - Intronic
1104825936 12:131709894-131709916 CTCTTAAAGCTAATTCTGGTGGG + Intergenic
1105993842 13:25650576-25650598 CCCTTAACGCTACTTCTGTTTGG - Intronic
1106971695 13:35148061-35148083 ATCATAAAGATAATACTGGTGGG + Intronic
1108079411 13:46719258-46719280 CACTTAAAGCTCAGTCTGTTTGG - Intronic
1108564791 13:51685135-51685157 GGCTTAAAGCTAATTCTTGAAGG - Intronic
1111007238 13:82263854-82263876 ATCTTAAAGCTAATGCAGTTTGG - Intergenic
1114760929 14:25313258-25313280 CTCTTAGAGTTTATTCTGCTTGG + Intergenic
1115416828 14:33145097-33145119 ATCTTAAACAAAATTCTGGTTGG - Intronic
1118554831 14:67006440-67006462 CAATTAAATCTAATTCTGTTTGG + Intronic
1119010645 14:70983792-70983814 CTTTTCAAGCTCATTCTTGTTGG - Intronic
1119228012 14:72958793-72958815 CTCCTACAGCTAATTCTGCAGGG + Exonic
1130711474 15:86285903-86285925 CTCTCATAGCTAATACTGCTTGG + Intronic
1133560062 16:6942453-6942475 TTCTTAAAGCTCATCCTGGCTGG - Intronic
1140214954 16:72999892-72999914 CTCTTAGAGCTGAATCTGGATGG - Intronic
1140351057 16:74262392-74262414 CATTTAATTCTAATTCTGGTGGG - Intergenic
1140812930 16:78595554-78595576 CTCTGATAGCTAACTGTGGTGGG - Intronic
1141321172 16:83010346-83010368 CTCTTACAGTTAATGCAGGTGGG - Intronic
1142104064 16:88292575-88292597 CTCGTACAGCTAAGTCGGGTGGG + Intergenic
1146826874 17:36030738-36030760 CGCTTTAAACTAATTCTGTTTGG - Intergenic
1152626952 17:81392264-81392286 CACTTGAAGCAAATTCTAGTGGG - Intergenic
1155217436 18:23655795-23655817 CTTTAAAAGATAATTCTGGCCGG + Intronic
1156191825 18:34729020-34729042 CTCTTCCAGGTAATTGTGGTGGG - Intronic
1157194693 18:45611187-45611209 CTATTAAAGGTATTCCTGGTGGG - Intronic
1158053309 18:53250153-53250175 GTCTTAAAGCTACTTCTTGAGGG - Intronic
1158127189 18:54114035-54114057 TTCTTAAAGCTGATTTTGATAGG + Intergenic
1167297318 19:48659139-48659161 CTCTTGAAGCCAATTCAGTTGGG - Intergenic
925572138 2:5324090-5324112 CTCTTAAATCTATTTCTGTTGGG - Intergenic
928896963 2:36276920-36276942 ATCTTAATGCTAATCATGGTCGG + Intergenic
930392269 2:50777032-50777054 CTTTGAAAGCTAATTCTAATAGG - Intronic
931079073 2:58748887-58748909 CTATTTAACCTACTTCTGGTTGG + Intergenic
931303645 2:61006559-61006581 CTCTTACAGATAGTTGTGGTGGG + Exonic
932260468 2:70322603-70322625 CACTCAAAACTAATTCTGGTGGG + Intergenic
935530635 2:104228911-104228933 CTCTTAAATTTAACTCTGTTTGG + Intergenic
936291973 2:111233025-111233047 CTCTTTGAGCTTATTCTGTTTGG + Intergenic
936639003 2:114291558-114291580 TTCATAAAGCTAATTCAGGCTGG - Intergenic
936971958 2:118185104-118185126 CTCTTAACGCTATTTCATGTTGG + Intergenic
937703063 2:124886116-124886138 TACTTAAAGATGATTCTGGTTGG + Intronic
940842235 2:158597552-158597574 CTCCTCAAGGTAATTCTGGAAGG + Intronic
941676380 2:168347259-168347281 CTCTTAATACTAGTCCTGGTAGG - Intergenic
941677402 2:168358200-168358222 TTCTTAAAGCTAATTTTAATTGG - Intergenic
941693703 2:168528313-168528335 CTCTTAAAGCCATCTCTAGTGGG + Intronic
942039449 2:172044258-172044280 CTCTTAAAAATAAGTCAGGTGGG + Intronic
943694002 2:190903493-190903515 CCCTTGAAGCAAATTCCGGTAGG + Intronic
943696059 2:190932748-190932770 CTTTTAAAGCAAGTTCTTGTTGG - Intronic
1170404108 20:16018561-16018583 CGGTTAAAGATAATTTTGGTGGG - Intronic
1171439593 20:25149427-25149449 CTCTGAAAGAGAATTCTGCTGGG + Intergenic
1173905524 20:46625750-46625772 CACTTCAAGCTCATTCTTGTTGG - Intronic
1177382476 21:20362658-20362680 CCCATAAAGCTGATTGTGGTTGG + Intergenic
1177815490 21:25971685-25971707 CTGTTAATGCTAATTCTTTTTGG - Intronic
949980106 3:9497196-9497218 GTCTTAAGCATAATTCTGGTTGG - Intergenic
951981616 3:28573213-28573235 CTCTTAAACTTAAATGTGGTAGG + Intergenic
962288254 3:134106566-134106588 TCCTTAAAACGAATTCTGGTGGG + Intronic
962515845 3:136151114-136151136 CTTTTAAACCTACTCCTGGTAGG - Exonic
964762061 3:160143724-160143746 CTCTTAATGATAATTCAGCTGGG - Intergenic
967678852 3:192335440-192335462 CTCTTCAATCTAATTCCCGTGGG - Exonic
967717592 3:192780720-192780742 CTACTTAAACTAATTCTGGTAGG - Intergenic
969901362 4:10353584-10353606 CTCTTAAATCAAATTATGCTGGG - Intergenic
970165135 4:13228583-13228605 CTCTTGAAGCTTAGTTTGGTTGG - Intergenic
970388086 4:15576939-15576961 CTCTGAAAGTTATTTCTGGTGGG + Intronic
971961738 4:33496871-33496893 ACCTTAAAGCTTATTCAGGTTGG - Intergenic
972442212 4:39105781-39105803 CTCCAAAAGCTAGTACTGGTGGG + Intronic
977130555 4:93231060-93231082 CTCTAAGAGCTGATTGTGGTGGG - Intronic
983517078 4:168669258-168669280 CTTTTAAAGCTAATTATTGTGGG - Intronic
988634486 5:32968440-32968462 CCCTTAAAGCTAATGCCAGTTGG - Intergenic
989768716 5:45117176-45117198 CTCTGGAAGCTTATTCTGATAGG + Intergenic
993067377 5:83116132-83116154 TTTTTAAAGCTAATTTTGCTTGG + Intronic
998723360 5:144979262-144979284 CTCTTGAAGCTTATTTTGTTTGG + Intergenic
998818202 5:146034481-146034503 CACTTAAAGCTCCTTCTGGATGG - Intronic
1000578477 5:163006478-163006500 ACCTTCAAGCTAATTCTTGTTGG + Intergenic
1000909579 5:167005984-167006006 GTCTTGAAGTTAATTGTGGTAGG + Intergenic
1003363168 6:5447925-5447947 CTCTTCAAGGTAATTCTTCTGGG - Intronic
1006513819 6:34535283-34535305 CTCTGAGAGCTATTTGTGGTTGG + Intergenic
1015941773 6:138459657-138459679 CTCTTATATCTCATTCTAGTGGG + Intronic
1019024345 6:168944958-168944980 TTCTTGAAGCTAATTTTGCTAGG - Intergenic
1019838184 7:3411939-3411961 CTCTACATGCTAATTCTGTTTGG - Intronic
1021262083 7:18470807-18470829 CTCTGAAATCTAATTCAGGAAGG - Intronic
1022279686 7:28894399-28894421 CTGTTAAAGCTAATTATTATTGG + Intergenic
1022677861 7:32516583-32516605 CTTTTAAAACTAATTTTGTTGGG - Intronic
1023066517 7:36382787-36382809 TTCTTAAAGCTATTTTTGGCTGG - Intronic
1028462033 7:91104823-91104845 CTTTTAAAACTAATTCTGTTAGG - Intronic
1028895761 7:96039935-96039957 TTTTTAAAGGTAATTCTGGCTGG + Intronic
1031959900 7:127979426-127979448 CACTCTAAGCTAATTCTGATTGG + Intronic
1035168449 7:157005233-157005255 CTTTTAAAATTAATTTTGGTTGG - Exonic
1043242447 8:77952362-77952384 CTATTCATGCTAATTCTGCTAGG - Intergenic
1047081688 8:121468820-121468842 CTCTTAATGGTACTTCTAGTAGG + Intergenic
1053177535 9:35938844-35938866 CTTTTAAAACTAAATCTGGATGG + Intergenic
1053433789 9:38061601-38061623 CTTTTAAAGCTAATTTTTATGGG + Intronic
1059350162 9:113658706-113658728 CTCCTACAGCTAATGCTGGTAGG + Intergenic
1060256978 9:122039825-122039847 CTCTGAAAGCTTATTCTTTTGGG - Intronic
1061420345 9:130470124-130470146 CTCTTAAGGCTGAGTCAGGTGGG + Intronic
1186709776 X:12181520-12181542 TTGTTTAAGCTAATTTTGGTTGG - Intronic
1187999313 X:24964835-24964857 CTCCTGATGCTAATTCTGGGAGG + Intronic
1188646798 X:32578730-32578752 CTCTTAACGCCAATACTGATGGG - Intronic
1188786136 X:34348969-34348991 CTTTAATAGATAATTCTGGTTGG - Intergenic
1195333401 X:103825744-103825766 CTCTTAAAGGTCATTCTCTTGGG - Exonic
1201643822 Y:16205611-16205633 CTCTCTAAACTAATCCTGGTTGG - Intergenic
1201658993 Y:16379710-16379732 CTCTCTAAACTAATCCTGGTTGG + Intergenic