ID: 1104831563

View in Genome Browser
Species Human (GRCh38)
Location 12:131755866-131755888
Sequence AGGACACCCCCAGCACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 1, 2: 2, 3: 30, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104831563 Original CRISPR AGGACACCCCCAGCACCAGC TGG (reversed) Intronic
900382417 1:2391495-2391517 AGGGCACCCCGAGCTCCCGCGGG - Exonic
900493610 1:2965908-2965930 AGGACAGACCCAGCACCTCCAGG + Intergenic
900520233 1:3101867-3101889 CGGAGACCCCCAGTCCCAGCTGG + Intronic
901068959 1:6507849-6507871 GGGACACCCCCAGCTCCTGTGGG - Intronic
901321524 1:8343155-8343177 TGGGCTCCCCCAGCACCAGCCGG - Intronic
902374093 1:16022174-16022196 AGGAAAACCCCAGGACCAGAAGG - Intronic
902642159 1:17774005-17774027 AGGCCAACCCCTGCACCATCTGG - Intronic
902642388 1:17775174-17775196 AGGCCAACCCCTGCACCATCTGG - Intronic
904235725 1:29115816-29115838 TGGGCACCCTCAGCCCCAGCAGG - Intronic
904678834 1:32214995-32215017 TGGACATCCCCAACAACAGCAGG - Intronic
905391051 1:37635369-37635391 AGGACACCTCCAGAGGCAGCTGG + Intergenic
907460982 1:54605306-54605328 AACCCACCCCCAGCCCCAGCAGG - Intronic
907506874 1:54925526-54925548 CAGACACACCCAGCACCAGCAGG - Intergenic
912648933 1:111421221-111421243 AGGACTCTCCCACCCCCAGCTGG - Intronic
914815186 1:151058006-151058028 AGGAAACCCCCAACACCAGCAGG + Exonic
915031838 1:152886601-152886623 ACGAATCCCCCAGGACCAGCTGG - Intergenic
915366467 1:155319655-155319677 AGAACTCCCCCATCTCCAGCAGG - Exonic
915693523 1:157715734-157715756 ACGACACCCCCAGATCCAGGCGG - Intergenic
918071868 1:181139316-181139338 AAGCCTCTCCCAGCACCAGCTGG - Intergenic
919756078 1:201066906-201066928 GGGACACGGCCACCACCAGCAGG + Exonic
920843629 1:209575654-209575676 GGGACACATCCAGCCCCAGCTGG - Intergenic
920953576 1:210597426-210597448 AGGACCCACCCAGGACCAGGAGG - Intronic
921068521 1:211639862-211639884 AAGAAACCCCAAGGACCAGCAGG - Intergenic
921903830 1:220475885-220475907 AGTACACCCCCCGCAGCCGCTGG + Intergenic
922745131 1:228039077-228039099 TGGACACCCCCAGCTCTGGCAGG - Intronic
922800661 1:228363305-228363327 AGGAGACCCCCAACACCTGGGGG - Intronic
924278265 1:242409942-242409964 AGGAAAGCCCCAGCTCTAGCCGG - Intronic
1062798729 10:363535-363557 AGGCCACACACAGCACCCGCGGG + Intronic
1063947729 10:11193548-11193570 AAGACAGCCCCAGCCCCAGACGG - Intronic
1064425609 10:15226530-15226552 AGGACACCTCCTGAACCATCTGG + Intronic
1065245073 10:23748399-23748421 AGCACAGCCCCAGCACTAGCAGG + Intronic
1065322435 10:24521940-24521962 AGGCCACCCCCAGCACGATGAGG - Intronic
1067080793 10:43211220-43211242 AGGGCACCCCTCTCACCAGCAGG - Intronic
1067661323 10:48238089-48238111 AGCAGATCCCCAGGACCAGCAGG - Exonic
1067750587 10:48968772-48968794 GAGCCACCCCCAGCCCCAGCTGG - Intronic
1067916764 10:50408201-50408223 AGAACACCACCAGCAGCAGAAGG - Intronic
1070555538 10:77524936-77524958 CGGCCTCCCTCAGCACCAGCAGG + Intronic
1070592269 10:77809648-77809670 AGTGCACCCCAAGCTCCAGCTGG + Exonic
1070896491 10:79986836-79986858 AGCACATCCCCAGCAGCTGCTGG - Intergenic
1072659888 10:97357267-97357289 GGCTCACCCCCAGCGCCAGCAGG + Intronic
1073207038 10:101775015-101775037 GGGGAACCCCCAGCACCTGCTGG - Intronic
1074517179 10:114180962-114180984 AGGAAGCCCCCAGCAACATCAGG + Intronic
1075309561 10:121401840-121401862 AGGACACTTCCATCACCACCAGG - Intergenic
1075488670 10:122847865-122847887 AGGACACCCCCATTAGCAGGAGG - Intronic
1075560905 10:123467773-123467795 AGGACACCCCCCTCCCCACCGGG - Intergenic
1077015440 11:397154-397176 AGGCCAGCTCCAGCTCCAGCCGG + Exonic
1077015555 11:397596-397618 AGGCCGCTCCCAGCACCTGCAGG - Exonic
1077101557 11:824769-824791 AGCATCCCCGCAGCACCAGCTGG + Exonic
1077131872 11:977012-977034 AGCACCCCCCCAGAGCCAGCAGG - Intronic
1077194327 11:1271920-1271942 AAGGGACCCGCAGCACCAGCAGG - Intergenic
1077246959 11:1544366-1544388 GGGCCATCCCCAGCACCAGAAGG + Intergenic
1079096872 11:17516838-17516860 AGGACAGCTCCAGCAGGAGCGGG + Intronic
1079135657 11:17774835-17774857 AGGACAGCACCAACACCACCGGG - Intronic
1081549127 11:44095992-44096014 AGGCCACCCCCAGCCCCGCCGGG + Intronic
1083228360 11:61299137-61299159 AGGCAACCCCCAGGCCCAGCAGG + Intergenic
1083968664 11:66058871-66058893 AGGACACCCCTCGCACCCGCTGG - Exonic
1085315693 11:75543569-75543591 AGCACACCCACAGAGCCAGCAGG - Intergenic
1088604210 11:111512797-111512819 AGGACACCCCCGGGCCCAGCGGG - Intergenic
1090119473 11:124009779-124009801 AGTACACCCTGATCACCAGCAGG - Intergenic
1090413200 11:126523078-126523100 AGGGCAGCACCAGCACCAACAGG + Intronic
1091387844 12:105919-105941 AGGGCAGCCCAAGCACCAACAGG - Intronic
1091489010 12:916700-916722 GGGACACCCACAGCTGCAGCAGG - Exonic
1091510754 12:1123016-1123038 ACCACTCCCCCAGCTCCAGCTGG + Intronic
1092183025 12:6458941-6458963 AGGACACTCCCAGTACCTGGTGG - Exonic
1092272295 12:7032805-7032827 AGGACCCCACCGACACCAGCTGG - Intronic
1093970221 12:25369511-25369533 AGTACACCCCCCGCAGCCGCTGG - Intergenic
1096829623 12:54304293-54304315 TGTACACCACCAGCAGCAGCAGG + Intronic
1096954961 12:55516655-55516677 ACCACACCCCCAGCTCCAGGTGG + Intergenic
1096983898 12:55744129-55744151 AGGACCCCCGCAGCCCCAGCTGG + Intronic
1098171727 12:67753679-67753701 AGGAAGCCCGCAGCAGCAGCAGG + Intergenic
1101529698 12:105562824-105562846 ATGAAATTCCCAGCACCAGCTGG + Intergenic
1103005330 12:117416269-117416291 AGGTGACCCCCAGCATCACCAGG + Intronic
1103783391 12:123414329-123414351 AGCACACCCTCAGCAGCCGCTGG + Exonic
1104252493 12:127108849-127108871 AGGTCCCTCACAGCACCAGCTGG + Intergenic
1104831563 12:131755866-131755888 AGGACACCCCCAGCACCAGCTGG - Intronic
1105255044 13:18738792-18738814 AGGGCAAACCCAGCACCAGGAGG + Intergenic
1106411618 13:29514952-29514974 TGGAGACCTCCAGCACCTGCGGG - Intronic
1106770570 13:32957504-32957526 ATGGTACCCCCAGCCCCAGCTGG - Intergenic
1108213283 13:48159540-48159562 AAAACACCCCCTGCAGCAGCAGG + Intergenic
1109219856 13:59630003-59630025 AGGACTCACCCAGCACAAGAGGG - Intergenic
1112222793 13:97508111-97508133 AGGTCAGCACCAGCACCACCTGG - Intergenic
1113603666 13:111589439-111589461 GGTAGACACCCAGCACCAGCAGG + Intronic
1113879300 13:113614684-113614706 AGGCCCCCCACAGCAGCAGCAGG - Intronic
1117189135 14:53274067-53274089 AGGACTCCCCCAGTAGCAGGTGG - Intergenic
1122400942 14:101466978-101467000 AGGACATCAGCAGCACCAGGGGG + Intergenic
1122789487 14:104178337-104178359 AGGGCGCCCCCACCACCACCAGG - Intronic
1122945980 14:105009714-105009736 TGGACACCCCCAACTCCAGCCGG + Exonic
1123054191 14:105561533-105561555 ATGACACCCCCAGGACAGGCTGG - Intergenic
1123054910 14:105564751-105564773 AGGAAGCCCCCAGCCCCAGGCGG + Intergenic
1123078775 14:105681952-105681974 ATGACACCCCCAGGACCGGCTGG - Intergenic
1123079353 14:105684330-105684352 AGGAAGCCCCCAGCCCCAGGCGG + Intergenic
1124149693 15:27166601-27166623 AGCCCACCCCCTACACCAGCAGG + Intronic
1124340992 15:28889009-28889031 AGAGCACCCCCAGCCCCCGCTGG - Intronic
1125474754 15:40039317-40039339 AGGACAGCCCCAGCGCCTCCGGG - Intergenic
1129444674 15:75608604-75608626 AGGGAAGCCCCAGCATCAGCTGG + Intronic
1129458486 15:75688315-75688337 AGGACACCCTCACCACCCTCAGG + Exonic
1129458767 15:75689495-75689517 CCGACACCTCCAGCACCAGCTGG + Exonic
1129644857 15:77420297-77420319 AGGTCTCCCTCAGCCCCAGCGGG + Intergenic
1130273090 15:82462583-82462605 CTGACACCTCCAGCACCAGCTGG - Intergenic
1130273346 15:82463748-82463770 AGGACACACCCACCACCCTCGGG - Intergenic
1130465442 15:84189954-84189976 CTGACACCTCCAGCACCAGCTGG - Intergenic
1130486992 15:84403689-84403711 AGGACACACCCACCACCCTCGGG + Intergenic
1130487250 15:84404866-84404888 CTGACACCTCCAGCACCAGCTGG + Intergenic
1130498823 15:84483582-84483604 CTGACACCTCCAGCACCAGCTGG + Intergenic
1130587731 15:85194549-85194571 CTGACACCTCCAGCACCAGCTGG - Intergenic
1130587987 15:85195714-85195736 AGGACACACCCACCACCCTCGGG - Intergenic
1131297926 15:91168431-91168453 AGCACTCCCCCAGCAGCTGCAGG - Intronic
1132033450 15:98458312-98458334 AGACAACCCCCAGTACCAGCTGG + Intronic
1132865420 16:2090694-2090716 AGGCTACCCCGAGCACCACCAGG + Exonic
1132904303 16:2274264-2274286 AGCACGCTGCCAGCACCAGCAGG - Intergenic
1132996801 16:2827696-2827718 AGGACTCCAGAAGCACCAGCTGG - Intergenic
1133271010 16:4610826-4610848 AGCCCTCCCCCTGCACCAGCTGG + Intronic
1135322959 16:21509065-21509087 AGGAGACCCCCAGGACCGACAGG + Intergenic
1136334443 16:29602250-29602272 AGGAGACCCCCAGGACCGACAGG + Intergenic
1137587791 16:49674552-49674574 AGTCCACCCCCTGCACCACCAGG + Intronic
1138179731 16:54933215-54933237 AGGGCCCCCCCCGCACCGGCGGG + Exonic
1139476757 16:67206670-67206692 AGGGCTCCCCCAGTACCTGCAGG - Intergenic
1139952311 16:70678383-70678405 AGGAGACCTGCAGCCCCAGCTGG - Exonic
1140137101 16:72216433-72216455 AGGACACCATCAGCAGCAGACGG + Intergenic
1141579852 16:84989901-84989923 AGGAGACGCCCAGCAGCTGCAGG - Intronic
1142196480 16:88741583-88741605 AGGACATCCCCAACGCCATCCGG - Exonic
1143092552 17:4457644-4457666 AGGGGGCCCCCAGCCCCAGCTGG - Intronic
1144719943 17:17462275-17462297 GGGACACCCTCAGCCCCAGATGG + Intergenic
1145200942 17:20944229-20944251 AAGACACACCCTGGACCAGCAGG - Intergenic
1145780131 17:27557314-27557336 AAGACACCACCAGCATCAGGAGG + Intronic
1147310307 17:39592195-39592217 ATGACGCCCCCAGGACCGGCTGG + Intergenic
1147643585 17:42020177-42020199 GGGGCCCCCGCAGCACCAGCCGG - Intronic
1147790735 17:43013085-43013107 AGGACACACCCAGCAGGACCCGG + Exonic
1148196897 17:45720460-45720482 AAGACACTCCCAGACCCAGCAGG + Intergenic
1149362428 17:55910089-55910111 AGAACTTCCCCAGTACCAGCCGG - Intergenic
1149576169 17:57715256-57715278 GGGAGGCCCCCAGCCCCAGCAGG - Intergenic
1152068636 17:78124610-78124632 AGGCCACCAGCAGCAGCAGCAGG + Exonic
1152222338 17:79075462-79075484 AGGCCACCCCTTCCACCAGCCGG - Intronic
1153691681 18:7600716-7600738 ATGGCACAGCCAGCACCAGCAGG - Intronic
1154435982 18:14341814-14341836 AGGGCAAACCCAGCACCAGGAGG - Intergenic
1156376969 18:36523462-36523484 AGGCCACATCCAGCATCAGCAGG + Intronic
1159393809 18:67830514-67830536 AGGGCACCACCAGCAGCACCTGG - Intergenic
1160681345 19:412954-412976 AGGACACCCCGGGTATCAGCTGG - Intergenic
1160910561 19:1471984-1472006 TGGGCACCTCCAGCACCTGCTGG - Exonic
1160990117 19:1857030-1857052 GGGACATCCGCAGCCCCAGCCGG + Intronic
1161308990 19:3583591-3583613 AGGAGACCCCAGGCACCAGGAGG - Intergenic
1161993536 19:7698715-7698737 AGGACACCCCCAGCTCCATGTGG - Intronic
1162212392 19:9102742-9102764 AGGACAGCCTCAACACCATCAGG + Exonic
1163182744 19:15615679-15615701 AGGAGGCCCCGACCACCAGCAGG - Exonic
1163395967 19:17061638-17061660 AGGACACCCCCACCACCGCAAGG - Intronic
1163653317 19:18531638-18531660 AGGAGACCCCCAGCTCCAGCTGG + Intergenic
1163736251 19:18982868-18982890 AGGACACCTTCAGGATCAGCTGG - Intergenic
1165120624 19:33556357-33556379 ACCACACCACCAGCACCAGCAGG - Intergenic
1165937381 19:39397658-39397680 AAGACACCCGCACCACCTGCTGG + Exonic
1166218893 19:41353113-41353135 GGGAGACCCCCAGCCCCTGCAGG - Exonic
1166846850 19:45733707-45733729 GGGCCTCCCCCAGCACTAGCTGG + Intronic
1167667964 19:50833616-50833638 ACCACACCCCCAGACCCAGCTGG - Intronic
1168642022 19:58037129-58037151 ATGACACCACCACCAGCAGCAGG - Intronic
927430796 2:23024803-23024825 AGGAAACCACCACCACCACCAGG - Intergenic
927570166 2:24152652-24152674 ATGACACCCCCAGCTCCAGGTGG - Intronic
927682545 2:25149544-25149566 AGGACACCCCCACCCCCCTCAGG - Intronic
931996699 2:67845702-67845724 CAGACACCCCCAGCAGCAGATGG + Intergenic
932384838 2:71322981-71323003 AGAAAACCCCCAGTACCAGCAGG - Intronic
932421782 2:71605584-71605606 AGGGCATCCCCTGCCCCAGCAGG - Intronic
932466209 2:71925914-71925936 TGGCCTCCCCCAGCCCCAGCTGG - Intergenic
933712751 2:85339537-85339559 AAGACACCAGCATCACCAGCAGG - Intergenic
935049156 2:99509493-99509515 AGGAAAACTCCAGCACCAGAAGG + Intergenic
935881507 2:107570383-107570405 TGGACACTCACAGCACCATCCGG - Intergenic
942077228 2:172367135-172367157 AGGACACCTCCAGGACCGGAAGG - Intergenic
944428468 2:199608234-199608256 AGAACATCTCCAGCAGCAGCTGG + Intergenic
945179555 2:207077872-207077894 AGGACACCACCAGAAACACCAGG + Exonic
945872825 2:215245944-215245966 AGCACACCCTCTGCAGCAGCTGG + Intergenic
946414341 2:219532068-219532090 GGGACACCCCGAACCCCAGCTGG - Exonic
947736735 2:232459113-232459135 CGGACGCCCCCAGCAGCAGCAGG - Exonic
948836430 2:240628258-240628280 AGGACATCCCCAGAACCCACTGG - Intronic
949021258 2:241742609-241742631 AGAACTCCACCAGCACCAGGAGG - Intronic
1168812315 20:712026-712048 AGGAGACACCCAGAACCAGCAGG + Intergenic
1171085178 20:22231969-22231991 AGACCACCCCCAGCACGGGCTGG + Intergenic
1171195969 20:23199678-23199700 AGGACACCGACAGCCCCACCGGG + Intergenic
1172766349 20:37353136-37353158 TGTGCATCCCCAGCACCAGCGGG + Intronic
1173378916 20:42519068-42519090 AGAACATCTCCAGCACCAGAAGG + Intronic
1175177362 20:57120305-57120327 AGGACATGCCCGGCTCCAGCAGG - Intergenic
1175403883 20:58715028-58715050 AGGAGATCCTGAGCACCAGCCGG - Intronic
1175813949 20:61873951-61873973 AGGACACCCACAGGACCCTCGGG + Intronic
1177295392 21:19166778-19166800 AGTAATTCCCCAGCACCAGCTGG - Intergenic
1178918360 21:36722274-36722296 AGGGCACCCCCTGCCCCAGTTGG - Intronic
1181306317 22:21919200-21919222 AGCCCACCCCCACCAGCAGCAGG - Intergenic
1181758942 22:25044420-25044442 CCGACTCCCCCACCACCAGCGGG - Intronic
1182621773 22:31622393-31622415 AGGATACCCTGAGCACCAACAGG + Intronic
1182715397 22:32353557-32353579 CTGACACCACCAGCACCAGGGGG + Intergenic
1182779078 22:32852986-32853008 GGGACCCTCCCAGGACCAGCTGG - Intronic
1183090475 22:35518842-35518864 AGGCCACCCTCAGCCCCAGGTGG + Intergenic
1183293800 22:37018627-37018649 AGGACGCGTCCAGCACCCGCAGG + Exonic
1183329853 22:37213543-37213565 AGGACACACCCACTTCCAGCCGG + Intergenic
1183712159 22:39511375-39511397 CACCCACCCCCAGCACCAGCCGG - Exonic
1183786282 22:40030871-40030893 AGGACACTACCAGCACCTGGGGG + Exonic
1184431311 22:44442776-44442798 CCAACACCCCCAGCACCAGGAGG + Intergenic
1185171750 22:49298369-49298391 AGGACACCCCCAGCTCTCCCGGG - Intergenic
950088581 3:10278739-10278761 AGGACTCTCCCTGCACCTGCAGG + Exonic
950532396 3:13559878-13559900 AGGACTCCCCCCGCCCCAGGCGG + Intronic
950723572 3:14901306-14901328 AGGCCACCCCCATCAGCACCTGG + Intronic
950864304 3:16176512-16176534 AGGGCAGCCCCAGCCCCAGGAGG + Intronic
950974535 3:17226642-17226664 AGGACTACCCCAGCCCCAGAGGG + Intronic
957277468 3:78108533-78108555 AGCACACCCCCTGCAGCCGCTGG - Intergenic
962234060 3:133692940-133692962 TGGGCACACCCAGCCCCAGCTGG - Intergenic
968047253 3:195631305-195631327 AGGCCATCCCCAGCAGCCGCCGG - Intergenic
968551514 4:1226021-1226043 AGGCCTCCCCCAGGCCCAGCCGG + Intronic
968798040 4:2722186-2722208 AGGACAGCCACATAACCAGCAGG - Intronic
972247146 4:37257108-37257130 AGGCCACAGCCAGCACCACCTGG + Intronic
974761913 4:66287237-66287259 AGGAAACCTCCAGCACGAGATGG - Intergenic
975796873 4:78015391-78015413 AGGACTCCTCCAGCAGCTGCTGG + Intergenic
978342499 4:107733571-107733593 AGGAAACTCCCAGCAGCTGCTGG + Intergenic
982450320 4:155544723-155544745 AGGCCATCCCCACCCCCAGCTGG - Intergenic
985744353 5:1637859-1637881 AGGCCACCCCCAGCAGGTGCAGG + Intergenic
986528258 5:8704179-8704201 AGGACCCACCCAGCACCATGAGG + Intergenic
989681209 5:44031931-44031953 AGGACACACCCTGTACCAGAAGG + Intergenic
990490072 5:56295470-56295492 AGTACACCCTCCGCAGCAGCTGG - Intergenic
990496594 5:56354191-56354213 AGGACTCCCCCTGCACCTCCAGG + Intergenic
992336959 5:75781358-75781380 AAGAAACGCCCAGGACCAGCTGG + Intergenic
992519867 5:77539500-77539522 AGTACACCCCCTAGACCAGCAGG - Intronic
999240641 5:150125436-150125458 AGGACTGACCCAGCACAAGCTGG + Exonic
999712525 5:154331332-154331354 GGCACACCCCCACCACCAGCAGG - Intronic
999720334 5:154394692-154394714 AGGCCAGCCCAAGCACCAGAAGG + Intronic
1001156869 5:169280126-169280148 AGGAGACCCCCAGCGGAAGCTGG - Intronic
1002160080 5:177309880-177309902 AGCTCAGCCCCAGCAGCAGCAGG + Intronic
1002185457 5:177452726-177452748 AGGCCACGCCCAGGACCTGCTGG - Intronic
1002634272 5:180599360-180599382 TGGTCACCCCCAGCACCACTGGG + Intergenic
1002805230 6:567267-567289 AGGACGCCTGCAGCACCAGGAGG - Intronic
1003401301 6:5793309-5793331 AGGAAACCCCAGGCACCAGAGGG + Intergenic
1004720937 6:18266610-18266632 AGGAAACCCCCTGCCCCTGCAGG - Intergenic
1005898427 6:30197297-30197319 AGGACTCCCCCAACCCCAGCTGG - Intronic
1006018481 6:31102515-31102537 ACCACACCCCCAGCTCCAGGTGG - Intergenic
1006126127 6:31839565-31839587 AGGATATGCCCAGCACCAGGCGG - Exonic
1007176458 6:39901134-39901156 AAGACACCCCCATCATCATCAGG - Intronic
1007178151 6:39910315-39910337 AGGACACACACAGCTCCAACTGG - Intronic
1007633283 6:43284291-43284313 TGGACACAGCCATCACCAGCAGG + Exonic
1007728256 6:43929861-43929883 AGGACAGCCCCCTCACCAACAGG - Intergenic
1008270184 6:49482038-49482060 AGTACACCCCCCGCAGCCGCTGG + Intronic
1012841756 6:104337476-104337498 AGGACAGCAGCAGCAGCAGCAGG - Intergenic
1013057663 6:106600124-106600146 AGGAAGCCTCCAGCACCATCTGG + Intronic
1013281223 6:108638937-108638959 AGGACACCCCGAACACCATTAGG - Intronic
1015137654 6:129891666-129891688 AGGACACACCCAGCCCACGCAGG - Intergenic
1018385444 6:163299343-163299365 AGGACCCCCAGAGCAACAGCTGG - Intronic
1018719293 6:166560695-166560717 AGGCCACCCCCTCCACCTGCTGG - Intronic
1018908746 6:168089885-168089907 AGGGCACCACCAGCGCCAGCGGG - Intergenic
1019639872 7:2097622-2097644 CGGACACCCACAGCCACAGCCGG + Intronic
1023854070 7:44170415-44170437 AGGACAATGCCAGCAACAGCTGG - Intronic
1024969099 7:55052524-55052546 AGGACACAGCCAGCACGGGCAGG - Intronic
1026001045 7:66558887-66558909 ACCACAGCCCCAGCACCAGGTGG + Intergenic
1027187661 7:75981618-75981640 AGGCCACCCACCGCACCTGCGGG - Intronic
1029364348 7:100107469-100107491 TGGACACTCCCAGGACCAGAGGG + Exonic
1029458459 7:100682643-100682665 AGGACACCCCCAAGAGCGGCGGG - Exonic
1033217706 7:139505527-139505549 AGGACACTCCCAGAGCTAGCAGG - Intergenic
1033256371 7:139805102-139805124 AGGACACCCCCAGCACCACCAGG - Intronic
1034429449 7:151033890-151033912 CGGCTACCCCCAGGACCAGCAGG - Exonic
1035349985 7:158238918-158238940 AGGACGCCCCCAGGACAGGCTGG + Intronic
1036478644 8:9118045-9118067 TAGACACCCCCAGAACCAACTGG - Intergenic
1038473652 8:27846178-27846200 AGGACACCCCCAGCACAGTCAGG - Intergenic
1038521709 8:28238693-28238715 AGGGCACCCCCACCACCTGCTGG + Intergenic
1039165361 8:34673414-34673436 TGGACACCACAAGCAACAGCCGG + Intergenic
1039441408 8:37597922-37597944 AGGAACCCCCCATCACCAGGAGG + Intergenic
1040991254 8:53352664-53352686 AGGAGACTCCCAGCAGCTGCCGG - Intergenic
1048436365 8:134422274-134422296 AGAACACCCCCAGGACCAGAGGG + Intergenic
1048952627 8:139508847-139508869 AGAACAGCACCATCACCAGCAGG - Intergenic
1049265169 8:141664042-141664064 AGGCCACATCCAGCCCCAGCAGG - Intergenic
1049267368 8:141675845-141675867 TGGGCACCCCCAGCTCCAGTCGG + Intergenic
1049602871 8:143515991-143516013 AGCACACTCCCTGCACCTGCAGG - Intronic
1049655370 8:143794738-143794760 TGGGCAGCCCCAGCAGCAGCAGG + Intronic
1050914052 9:11108691-11108713 ACTCCACCCCCAGCATCAGCTGG + Intergenic
1052315014 9:27107474-27107496 AGGACATCACAAACACCAGCAGG - Intergenic
1052877035 9:33575191-33575213 TGGACACCCCCAGGACCACCAGG + Intergenic
1053376961 9:37615673-37615695 AGGACACCCCAAGCCCCAGATGG + Intronic
1053498969 9:38569203-38569225 TGGACACCCCCAGGACCACCAGG - Intronic
1055996908 9:82169751-82169773 AGGGCACCCTCTGCACCATCAGG - Intergenic
1057162021 9:92895538-92895560 TGGACACCCACAGGACCACCAGG - Intergenic
1057678413 9:97153694-97153716 TGGACACTCCCAGGACCACCAGG - Intergenic
1057996461 9:99824502-99824524 TTGCCACCCCCAGCCCCAGCTGG - Intronic
1059958297 9:119541222-119541244 AGGAGACCACCAACACCAGAGGG + Intergenic
1061233201 9:129326924-129326946 TGGCCACCCCCATCGCCAGCAGG + Intergenic
1061512010 9:131067291-131067313 AGGAACCCACCAGAACCAGCTGG + Intronic
1061546561 9:131308089-131308111 GGGGCACCGCCAGCACCAGGTGG - Exonic
1061680912 9:132242072-132242094 CGGCCAGCCCCAGCAGCAGCAGG - Exonic
1062076506 9:134592813-134592835 AGGAGAACCCCGGCTCCAGCAGG - Intergenic
1062114319 9:134799555-134799577 AGGACTCTCCCAGCAAAAGCAGG + Intronic
1062139211 9:134946091-134946113 CCCACACCCCCAGCACCAGGTGG - Intergenic
1062245811 9:135565528-135565550 AGGACACGCCCAGCCTCAGCTGG + Intronic
1186691894 X:11986164-11986186 ATGCCACCCCCAGCTCCAGGAGG + Intergenic
1191115059 X:56843768-56843790 AGGACACCTGCAGCACCTTCAGG + Intergenic
1192141003 X:68647316-68647338 AGGAGAGCCCCGGCCCCAGCAGG - Intergenic
1192788055 X:74354091-74354113 AGGCCCACCCCAGCACCAACTGG + Intergenic
1195885480 X:109633089-109633111 TGGACTCCCACAGCACCATCTGG + Intronic
1197837617 X:130712280-130712302 AGGGCTCCCCCAGCCCCACCAGG + Intronic
1202369537 Y:24187596-24187618 AGGACACACCCACCACCCTCGGG + Intergenic
1202501248 Y:25482521-25482543 AGGACACACCCACCACCCTCGGG - Intergenic