ID: 1104835156

View in Genome Browser
Species Human (GRCh38)
Location 12:131785332-131785354
Sequence CTCAGACCCCGGCATCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104835156_1104835162 22 Left 1104835156 12:131785332-131785354 CCTCCAGGATGCCGGGGTCTGAG 0: 1
1: 0
2: 2
3: 23
4: 177
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835156_1104835161 13 Left 1104835156 12:131785332-131785354 CCTCCAGGATGCCGGGGTCTGAG 0: 1
1: 0
2: 2
3: 23
4: 177
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104835156 Original CRISPR CTCAGACCCCGGCATCCTGG AGG (reversed) Intronic