ID: 1104835161

View in Genome Browser
Species Human (GRCh38)
Location 12:131785368-131785390
Sequence ATCTGCAGAAGCACAGCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 274}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104835153_1104835161 19 Left 1104835153 12:131785326-131785348 CCTGGCCCTCCAGGATGCCGGGG 0: 1
1: 0
2: 6
3: 39
4: 433
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274
1104835157_1104835161 10 Left 1104835157 12:131785335-131785357 CCAGGATGCCGGGGTCTGAGTGA 0: 1
1: 0
2: 1
3: 62
4: 774
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274
1104835150_1104835161 24 Left 1104835150 12:131785321-131785343 CCACTCCTGGCCCTCCAGGATGC 0: 1
1: 0
2: 3
3: 60
4: 463
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274
1104835156_1104835161 13 Left 1104835156 12:131785332-131785354 CCTCCAGGATGCCGGGGTCTGAG 0: 1
1: 0
2: 2
3: 23
4: 177
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274
1104835155_1104835161 14 Left 1104835155 12:131785331-131785353 CCCTCCAGGATGCCGGGGTCTGA 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274
1104835158_1104835161 2 Left 1104835158 12:131785343-131785365 CCGGGGTCTGAGTGATCCCGAGC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1104835161 12:131785368-131785390 ATCTGCAGAAGCACAGCCTGTGG 0: 1
1: 0
2: 5
3: 46
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104835161 Original CRISPR ATCTGCAGAAGCACAGCCTG TGG Intronic