ID: 1104835162

View in Genome Browser
Species Human (GRCh38)
Location 12:131785377-131785399
Sequence AGCACAGCCTGTGGCATTTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 244}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104835160_1104835162 -6 Left 1104835160 12:131785360-131785382 CCGAGCTGATCTGCAGAAGCACA 0: 1
1: 0
2: 0
3: 39
4: 631
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835153_1104835162 28 Left 1104835153 12:131785326-131785348 CCTGGCCCTCCAGGATGCCGGGG 0: 1
1: 0
2: 6
3: 39
4: 433
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835157_1104835162 19 Left 1104835157 12:131785335-131785357 CCAGGATGCCGGGGTCTGAGTGA 0: 1
1: 0
2: 1
3: 62
4: 774
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835156_1104835162 22 Left 1104835156 12:131785332-131785354 CCTCCAGGATGCCGGGGTCTGAG 0: 1
1: 0
2: 2
3: 23
4: 177
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835159_1104835162 -5 Left 1104835159 12:131785359-131785381 CCCGAGCTGATCTGCAGAAGCAC 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835158_1104835162 11 Left 1104835158 12:131785343-131785365 CCGGGGTCTGAGTGATCCCGAGC 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244
1104835155_1104835162 23 Left 1104835155 12:131785331-131785353 CCCTCCAGGATGCCGGGGTCTGA 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1104835162 12:131785377-131785399 AGCACAGCCTGTGGCATTTGCGG 0: 1
1: 0
2: 4
3: 29
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104835162 Original CRISPR AGCACAGCCTGTGGCATTTG CGG Intronic