ID: 1104837578

View in Genome Browser
Species Human (GRCh38)
Location 12:131801534-131801556
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 3, 2: 4, 3: 7, 4: 60}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104837573_1104837578 24 Left 1104837573 12:131801487-131801509 CCGTGGCTCGTGTTTGCCGTGGC 0: 3
1: 7
2: 2
3: 6
4: 133
Right 1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG 0: 1
1: 3
2: 4
3: 7
4: 60
1104837575_1104837578 8 Left 1104837575 12:131801503-131801525 CCGTGGCTCGTGTTTGCCGTGGC 0: 3
1: 7
2: 2
3: 6
4: 133
Right 1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG 0: 1
1: 3
2: 4
3: 7
4: 60
1104837577_1104837578 -8 Left 1104837577 12:131801519-131801541 CCGTGGCTCGTGTTTGCCATGGC 0: 1
1: 3
2: 7
3: 62
4: 486
Right 1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG 0: 1
1: 3
2: 4
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104837578 Original CRISPR GCCATGGCCCGTGTTTGCCG TGG Intergenic
903344794 1:22677259-22677281 GGCCAGGCCTGTGTTTGCCGTGG - Intergenic
903818009 1:26079313-26079335 GCCAGGGCCTGTGTTTGTCCCGG - Intergenic
904622498 1:31783765-31783787 GGCATGGACCTTGTTTGCCCAGG - Intergenic
916070781 1:161168444-161168466 GCCATGGACAGTCTCTGCCGTGG + Exonic
917516941 1:175716041-175716063 GCCAAGGCCAGTGTCTGCGGGGG - Intronic
1064153978 10:12888385-12888407 GCCCTGGCCCTTGCTTGCTGGGG + Intergenic
1067662001 10:48243259-48243281 GCCATGGCCTGTGCTTCCCAAGG - Intronic
1071873462 10:89819110-89819132 GCCATGGCCCCTTTTAGCCATGG + Intergenic
1072424011 10:95314049-95314071 GACATGCCCAGGGTTTGCCGTGG - Exonic
1076774351 10:132686126-132686148 GCCAGGGCCCAGGTTAGCCGGGG + Intronic
1077021672 11:419797-419819 GGCAGGCCCCGTGTTGGCCGGGG - Intronic
1077406641 11:2385358-2385380 GCGACGGCCCGTGGTTGCCCTGG - Intronic
1080002340 11:27363491-27363513 GGCCTGTCCCTTGTTTGCCGTGG + Exonic
1081595926 11:44459489-44459511 GCCATGGGCCTTTTTTGCCCTGG - Intergenic
1091810967 12:3397769-3397791 GCCATTGCCCGGGCTTGCTGAGG - Intronic
1094847916 12:34369500-34369522 GGGATGGCCCCTGTTGGCCGAGG + Intergenic
1102977981 12:117220320-117220342 GCCATAGCCCATGTCTGCCCAGG + Intronic
1103446888 12:121000523-121000545 GACTTGGCCCGTGTCTGCGGGGG + Intronic
1104837564 12:131801435-131801457 GCCGTGGCCCGTGTTTGCCGTGG + Intergenic
1104837570 12:131801470-131801492 GCCGTGGCTCGTGTTTGCCGTGG + Intergenic
1104837572 12:131801486-131801508 GCCGTGGCTCGTGTTTGCCGTGG + Intergenic
1104837574 12:131801502-131801524 GCCGTGGCTCGTGTTTGCCGTGG + Intergenic
1104837576 12:131801518-131801540 GCCGTGGCTCGTGTTTGCCATGG + Intergenic
1104837578 12:131801534-131801556 GCCATGGCCCGTGTTTGCCGTGG + Intergenic
1104837582 12:131801550-131801572 GCCGTGGCCCGTGTTTGCTGTGG + Intergenic
1104837587 12:131801585-131801607 GCCGTGGCCCGTGTTTGCCGTGG + Intergenic
1104837591 12:131801601-131801623 GCCGTGGCTCGTGTTTGCTGTGG + Intergenic
1104837593 12:131801617-131801639 GCTGTGGCCTGTGTTTGCCGTGG + Intergenic
1104837597 12:131801652-131801674 GCTGTGGCTCATGTTTGCCGTGG + Intergenic
1104837598 12:131801668-131801690 GCCGTGGCTCGTCTTTGCCGTGG + Intergenic
1104837600 12:131801684-131801706 GCCGTGGCCCGTGTTTGCCGTGG + Intergenic
1105336343 13:19473482-19473504 CCCATGGCCTGTGTTTGAGGTGG - Intronic
1202860477 14_GL000225v1_random:78734-78756 GCGGTGGCCTGTGTTTCCCGGGG - Intergenic
1130191835 15:81744536-81744558 GCCATGTCACGTGATTGCCCAGG + Intergenic
1133237164 16:4392712-4392734 GCCAGGGCCGGTGTGAGCCGAGG - Intronic
1136228574 16:28874216-28874238 GCTATGGCCATTGTTTGCTGTGG + Intergenic
1136553104 16:30992175-30992197 GCCATGGCCTGTGTGTACCTGGG + Exonic
1136909672 16:34135352-34135374 GCCCGGGCCTGTGTTTCCCGGGG + Intergenic
1138093389 16:54194338-54194360 GCCATGGCCCGTGTGGCCCGGGG - Intergenic
1138722982 16:59103584-59103606 ACCATGGCCCATGTTTACCTAGG + Intergenic
1141910642 16:87056438-87056460 GCCAAGGCCAGTATCTGCCGTGG - Intergenic
1158934833 18:62354774-62354796 GCCATGGCCAGGGGTTGCTGGGG + Intronic
1159900610 18:74041370-74041392 GCCGTGGCCCCTGTGTGCTGTGG - Intergenic
1161594046 19:5142246-5142268 GCCCAGGCCAGTGTGTGCCGGGG - Intronic
1163462686 19:17448443-17448465 GCCATGGCCCGTTCTTACGGCGG - Exonic
939282197 2:140078683-140078705 GCCAAGGCCCGTGGTTGGCTTGG + Intergenic
942385492 2:175438582-175438604 GCCATAGCCAGGGTTTGCCAAGG - Intergenic
1169189829 20:3651548-3651570 GCCGTGGCCAGTGTTTTCCTCGG + Intergenic
1171905151 20:30894074-30894096 GCCCGGGCCGGTGTTTCCCGGGG + Intergenic
1172894118 20:38287295-38287317 GCCATGGCCCCTGCTAGGCGGGG - Intronic
1175835917 20:61994348-61994370 GCCAGAGCCCGTGTTAGCCTTGG + Intronic
1176384736 21:6133708-6133730 GCCATGGCTCACGTTTGCCTGGG - Intergenic
1176515690 21:7781769-7781791 GCCATGGGCCCTGTGTGCCATGG + Intergenic
1178649718 21:34411781-34411803 GCCATGGGCCCTGTGTGCCATGG + Intergenic
1179738736 21:43404544-43404566 GCCATGGCTCACGTTTGCCTGGG + Intergenic
1180338577 22:11600254-11600276 GCCCGGGCCAGTGTTTCCCGGGG + Intergenic
1180563211 22:16639156-16639178 TCCATGGCCTGTGTTTGAGGTGG + Intergenic
1183531916 22:38360988-38361010 CCCATGGCCTGTGTTTGAGGTGG - Intronic
1184859494 22:47165165-47165187 GCCAGGGCTCGTGATTGCCAGGG + Intronic
950497257 3:13341165-13341187 GCCATGGCCTGTGGCTGCAGTGG + Intronic
954637044 3:52076598-52076620 GTCATGGCCTGTGATTGCCCTGG - Intronic
964665813 3:159170717-159170739 GCTATGGCCAGTCTTTGCCACGG + Intronic
967980468 3:195062248-195062270 GCCATGGCCTGTGTCTGCCCTGG + Intergenic
1001797271 5:174513081-174513103 GCCATGCCCCGTGCTTTCCAGGG + Intergenic
1004497225 6:16175902-16175924 GCCATGGCCCGCCATTGCAGTGG + Intergenic
1007698278 6:43747511-43747533 ACCATGGCCCATGGTTGCCCAGG - Intergenic
1020115003 7:5471279-5471301 GCCCCGGCCCGTGTGTTCCGAGG - Intronic
1032659173 7:133964391-133964413 ACCATGGCCCGTGTATACCTAGG - Intronic
1035521099 8:275454-275476 GACATGGCCCGATTCTGCCGCGG - Intergenic
1044806324 8:96011940-96011962 GCCATGTCCCCGGTTTGCCCTGG + Intergenic
1049844165 8:144792110-144792132 GCCATGGGCCGTGTGATCCGTGG - Exonic
1060487145 9:124054966-124054988 GCCCTGGCCCTTCTTTGCTGTGG + Intergenic
1061481237 9:130898674-130898696 GCCATGGCCTGTGACTTCCGTGG + Intergenic
1190708413 X:53048936-53048958 GCCATGGCCCGTGTGCTCCCAGG + Intergenic
1195935357 X:110120213-110120235 GCCTTGGCCCTTGTTTGCCTTGG + Intronic