ID: 1104838137

View in Genome Browser
Species Human (GRCh38)
Location 12:131805446-131805468
Sequence CTGATTCACCAGTTCTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104838136_1104838137 -1 Left 1104838136 12:131805424-131805446 CCATTTTATAAATGATGCATCGC No data
Right 1104838137 12:131805446-131805468 CTGATTCACCAGTTCTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104838137 Original CRISPR CTGATTCACCAGTTCTCTTC TGG Intergenic
No off target data available for this crispr