ID: 1104841521

View in Genome Browser
Species Human (GRCh38)
Location 12:131828234-131828256
Sequence GGTCCGCGGCATCACAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104841521_1104841539 12 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841539 12:131828269-131828291 GGACACGGCGGGGCGGGCGGGGG 0: 1
1: 0
2: 5
3: 85
4: 829
1104841521_1104841538 11 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841538 12:131828268-131828290 CGGACACGGCGGGGCGGGCGGGG 0: 1
1: 0
2: 3
3: 38
4: 405
1104841521_1104841534 5 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841534 12:131828262-131828284 CCGTCGCGGACACGGCGGGGCGG 0: 1
1: 0
2: 0
3: 3
4: 69
1104841521_1104841531 2 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841531 12:131828259-131828281 GTCCCGTCGCGGACACGGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 19
1104841521_1104841526 -3 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841526 12:131828254-131828276 ACCCAGTCCCGTCGCGGACACGG 0: 1
1: 0
2: 0
3: 0
4: 17
1104841521_1104841529 0 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841529 12:131828257-131828279 CAGTCCCGTCGCGGACACGGCGG 0: 1
1: 0
2: 0
3: 0
4: 28
1104841521_1104841537 10 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841537 12:131828267-131828289 GCGGACACGGCGGGGCGGGCGGG 0: 1
1: 0
2: 2
3: 58
4: 386
1104841521_1104841541 27 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841541 12:131828284-131828306 GGCGGGGGTGGCAGCGTCCGAGG 0: 1
1: 1
2: 2
3: 42
4: 548
1104841521_1104841536 9 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841536 12:131828266-131828288 CGCGGACACGGCGGGGCGGGCGG 0: 1
1: 0
2: 0
3: 28
4: 299
1104841521_1104841542 30 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841542 12:131828287-131828309 GGGGGTGGCAGCGTCCGAGGCGG 0: 1
1: 0
2: 1
3: 26
4: 294
1104841521_1104841525 -9 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841525 12:131828248-131828270 CCGCGGACCCAGTCCCGTCGCGG 0: 1
1: 0
2: 0
3: 5
4: 34
1104841521_1104841530 1 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841530 12:131828258-131828280 AGTCCCGTCGCGGACACGGCGGG 0: 1
1: 0
2: 0
3: 0
4: 18
1104841521_1104841540 15 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841540 12:131828272-131828294 CACGGCGGGGCGGGCGGGGGTGG 0: 1
1: 0
2: 12
3: 227
4: 1724
1104841521_1104841535 6 Left 1104841521 12:131828234-131828256 CCTTCCCTGTGATGCCGCGGACC 0: 1
1: 0
2: 0
3: 3
4: 80
Right 1104841535 12:131828263-131828285 CGTCGCGGACACGGCGGGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104841521 Original CRISPR GGTCCGCGGCATCACAGGGA AGG (reversed) Intergenic
904118158 1:28177320-28177342 GGTCAGGGGCATGACAGGGCAGG + Intronic
922494009 1:226041886-226041908 GGTGCTCGGCAGCCCAGGGACGG + Intergenic
1062792142 10:314520-314542 GATCCGGTGCAGCACAGGGAGGG - Intronic
1067788535 10:49270775-49270797 GGTGCACAGCAGCACAGGGAAGG + Intergenic
1071328705 10:84540747-84540769 GGGCCGCGGGATCCCAGGGCCGG + Intergenic
1075385649 10:122053535-122053557 GGTCACTGGCATCACAGGGAAGG - Intronic
1075689239 10:124384664-124384686 AGTCGGCAGCATGACAGGGACGG + Intergenic
1076696103 10:132248148-132248170 GGGCCGCGGCCGCACAGGCAGGG + Intronic
1076768396 10:132650148-132650170 GGTCTGAGGCATCCCAGGGATGG - Intronic
1078081695 11:8208947-8208969 GGTCCAAGGCAGCAAAGGGAAGG - Intergenic
1081782419 11:45722391-45722413 GGGCCTGGGCATCACAGGCAGGG + Intergenic
1088016710 11:105069912-105069934 GGTCCAAGGGATCACAGGAATGG + Intronic
1088019258 11:105099819-105099841 GGTCCAAGGGATCACAGGAATGG + Intronic
1088746313 11:112807784-112807806 GGTCCAGGGAAGCACAGGGATGG - Intergenic
1089557415 11:119321855-119321877 GGTCCCAGGCATCGCCGGGATGG - Intergenic
1089883807 11:121800425-121800447 GGAATGTGGCATCACAGGGATGG - Intergenic
1097271866 12:57780438-57780460 GGTCCCCAGCAGCAGAGGGAAGG - Exonic
1098491237 12:71081704-71081726 GGACCCCGGCCTCACAGGAATGG - Intronic
1101240763 12:102836780-102836802 TGTGAGCTGCATCACAGGGAAGG - Intergenic
1103270333 12:119668216-119668238 GGTCTGCGGGGACACAGGGAAGG - Exonic
1104841521 12:131828234-131828256 GGTCCGCGGCATCACAGGGAAGG - Intergenic
1110887136 13:80654676-80654698 GGTGGGCGGCTTCACAGGTATGG + Intergenic
1120451475 14:84672927-84672949 GGTCAGGGGCATGAGAGGGATGG - Intergenic
1121339403 14:93096195-93096217 GGGCTGCGGCATCTCAGGCAGGG - Intronic
1121883916 14:97525277-97525299 GGTCATGGGTATCACAGGGAAGG - Intergenic
1123930977 15:25171549-25171571 GCTCCGAGGCACCACTGGGATGG - Intergenic
1129540119 15:76341843-76341865 GGTCCGCGGGCTGGCAGGGAGGG - Exonic
1132841134 16:1979005-1979027 GGACCGCGCCATCCCAGGGCTGG - Exonic
1133040954 16:3059466-3059488 GGCCCGCGGCCTCACCCGGAGGG + Exonic
1137578210 16:49617786-49617808 GGTCAGTGGCATCAGATGGAAGG - Intronic
1142233388 16:88910255-88910277 GGGCTGCAGCATCACCGGGAAGG - Intronic
1145250265 17:21293526-21293548 GGTCCGGAGCATCACCGGGGAGG + Intronic
1147945567 17:44078365-44078387 GGGCCGGGGCGTCACAGGGCAGG + Exonic
1150621583 17:66811876-66811898 TGACCGCGGCATCTTAGGGAGGG - Intergenic
1154303453 18:13214364-13214386 GGTCCACAGGATCCCAGGGAGGG + Intergenic
1160160555 18:76466945-76466967 GTTCTGCAGCCTCACAGGGAAGG + Intronic
1160819175 19:1049835-1049857 GGTCGGGGGGCTCACAGGGAGGG - Intronic
1160853449 19:1205750-1205772 TGTCCGCGGCGGCGCAGGGAGGG + Intronic
1165086009 19:33347910-33347932 GGTCCCCAGCATCCCAGAGAAGG - Intergenic
1166139788 19:40799659-40799681 GGTCCGCGGCGACAGAGGAAAGG - Exonic
1167576439 19:50320190-50320212 GGTCCGGGGGATCAGAGGGTGGG + Intronic
1168084990 19:54039046-54039068 GGTCCAGGGCATGAGAGGGAAGG - Intergenic
1168549449 19:57280788-57280810 GATCCGCGGCATTCCCGGGATGG + Exonic
925889452 2:8421792-8421814 GGTCCCCGGGATCACAGGAGGGG + Intergenic
933714367 2:85349451-85349473 AGCCCGCTGAATCACAGGGATGG + Exonic
936075274 2:109397740-109397762 GGGCTGCGGCATCACCTGGAGGG - Intronic
942981072 2:182082782-182082804 GGTCTGGGGCAACACAGGAAAGG - Intronic
943520092 2:188938291-188938313 GGTCTGGGGCAGCACAGGGTGGG + Intergenic
946090746 2:217220738-217220760 GGTGGGTGGGATCACAGGGAGGG - Intergenic
947803910 2:232951353-232951375 GGTGCGCAGCATCAGTGGGATGG - Intronic
1175404214 20:58716451-58716473 GGTCTGAGGCCCCACAGGGAAGG + Intronic
1176231307 20:64034403-64034425 GGTCCCCAGAACCACAGGGAAGG - Intronic
1178425120 21:32473056-32473078 GGTCCTCAGCCTCACATGGAAGG + Intronic
1179218612 21:39387727-39387749 GGTAGGCGGCATCACTGGGCGGG + Intronic
1181433954 22:22899569-22899591 GGGCTGGGGCATCCCAGGGAGGG + Intergenic
1181575463 22:23791703-23791725 GGGTCGCAGCACCACAGGGAAGG - Intronic
1183032039 22:35113700-35113722 GCTCAGCGGCACCATAGGGATGG - Intergenic
1183032205 22:35114739-35114761 GCTCAGCGGAACCACAGGGATGG + Intergenic
1184097295 22:42323419-42323441 GGTCATTAGCATCACAGGGAAGG + Intronic
1184765270 22:46569051-46569073 GCTCCCCGGGATCACAGGGAGGG + Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950429930 3:12944870-12944892 GGTCGGGGGCAGCACAGTGAGGG - Intronic
958878575 3:99643357-99643379 GGTCATCACCATCACAGGGATGG + Intronic
968130235 3:196188891-196188913 GGGCCCTGGCTTCACAGGGAGGG - Intergenic
969544776 4:7818561-7818583 GGCCTGCGGCGTCACAGTGATGG + Intronic
984558375 4:181240728-181240750 GGGCCCCGTGATCACAGGGAAGG - Intergenic
1002162609 5:177324599-177324621 GGTACAGGGCATCACAGGGTGGG + Intergenic
1003074430 6:2971203-2971225 GGTCCGCGGCGTCACCGGCCGGG + Intronic
1006386062 6:33731643-33731665 GGTCCCCGACTTCAGAGGGAAGG - Intronic
1006750025 6:36371352-36371374 GGCCTGCGGCATCGCGGGGAAGG + Exonic
1008022035 6:46589789-46589811 GGTTGGGGGCAGCACAGGGATGG + Intronic
1035056429 7:156039544-156039566 GGTCCACAGCTTCACTGGGAGGG - Intergenic
1035817940 8:2561478-2561500 GATCCCCGGGTTCACAGGGAGGG - Intergenic
1037659977 8:20918094-20918116 GGTCCGTGACTTCCCAGGGAAGG + Intergenic
1045379405 8:101608372-101608394 GGTGCGCAGCTTCACAGGAATGG - Intronic
1049251979 8:141594079-141594101 GGTCAGGGGCCACACAGGGAGGG + Intergenic
1049812552 8:144582010-144582032 GGTCCTCGCCATCACCGGGCTGG + Intronic
1049812564 8:144582064-144582086 GGTCCTCGCCATCACCGGGCTGG + Intronic
1061591687 9:131602083-131602105 GGTCAGCGGCGTCCCTGGGAAGG - Exonic
1062127241 9:134870327-134870349 GGTCCGTGGGCTCACTGGGAGGG + Intergenic
1187407079 X:19013984-19014006 GGCCCGAGGCACCACTGGGATGG + Exonic
1190169417 X:48100034-48100056 GGTCCACAGCATCCCAGGGTAGG + Intergenic
1192634369 X:72803961-72803983 TGCCCGCAGCATCACAGGGTGGG - Intronic
1192647341 X:72916840-72916862 TGCCCGCAGCATCACAGGGTGGG + Intronic