ID: 1104841660

View in Genome Browser
Species Human (GRCh38)
Location 12:131828691-131828713
Sequence CCCGCGGAGACCCCCGGCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 149}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104841660_1104841671 -4 Left 1104841660 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1104841671 12:131828710-131828732 CGGGCCGGGTGGCGGGGACCGGG 0: 1
1: 0
2: 1
3: 77
4: 660
1104841660_1104841668 -10 Left 1104841660 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1104841668 12:131828704-131828726 TCTCCGCGGGCCGGGTGGCGGGG 0: 1
1: 0
2: 1
3: 11
4: 139
1104841660_1104841678 29 Left 1104841660 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1104841678 12:131828743-131828765 CAGTGCACGTCGGCGTCGCGCGG 0: 1
1: 0
2: 0
3: 2
4: 14
1104841660_1104841670 -5 Left 1104841660 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1104841670 12:131828709-131828731 GCGGGCCGGGTGGCGGGGACCGG 0: 1
1: 0
2: 5
3: 61
4: 745
1104841660_1104841674 19 Left 1104841660 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1104841674 12:131828733-131828755 AAGACCCCAGCAGTGCACGTCGG 0: 1
1: 0
2: 0
3: 14
4: 107
1104841660_1104841679 30 Left 1104841660 12:131828691-131828713 CCGGAGCCGGGGGTCTCCGCGGG 0: 1
1: 0
2: 1
3: 16
4: 149
Right 1104841679 12:131828744-131828766 AGTGCACGTCGGCGTCGCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104841660 Original CRISPR CCCGCGGAGACCCCCGGCTC CGG (reversed) Intronic
900109392 1:999201-999223 CCCGCGTAGACCTCGGGCGCTGG + Exonic
900113836 1:1020418-1020440 CCCGCCGGGACCCCCGCCCCAGG + Intronic
900198713 1:1392063-1392085 CTCTTGGAGACACCCGGCTCTGG + Intronic
900255071 1:1693581-1693603 GCCCCGAGGACCCCCGGCTCCGG + Intronic
900263814 1:1746847-1746869 GCCCCGAGGACCCCCGGCTCCGG + Intergenic
902053646 1:13583288-13583310 CCCCCGGAGCCCGCCCGCTCCGG + Intergenic
902691220 1:18110930-18110952 ATCCCGGAGACCCCCGGCTGGGG - Intronic
904003541 1:27351434-27351456 CCTGCGGAGAGGCTCGGCTCAGG - Exonic
906125718 1:43425928-43425950 CCATCAGAGACCCTCGGCTCTGG - Exonic
911219842 1:95234562-95234584 CACGCAGGGGCCCCCGGCTCCGG - Intronic
915740265 1:158113705-158113727 CCCGCGCCGACCTCGGGCTCCGG - Intergenic
917661455 1:177181352-177181374 CTCGCGGGGAGCCCCAGCTCAGG + Intronic
918951996 1:191151523-191151545 CCCGCCGGCACCACCGGCTCTGG + Intergenic
922116449 1:222618298-222618320 GCCGCGGAGACCCCCGGGGCCGG - Intronic
923631000 1:235649623-235649645 CCCGCGGACACCCGGGGCTCCGG + Intronic
924775767 1:247113773-247113795 TCTGCTGAGACCCCAGGCTCTGG + Intergenic
1063995050 10:11611386-11611408 CCCGCGGAGCCCGCCGCCGCCGG + Intronic
1064167802 10:13001610-13001632 CCCGGGGAGCCCGCCGGCCCGGG + Exonic
1067848017 10:49738320-49738342 CCTGCAGGGACCCCAGGCTCAGG + Intronic
1068114767 10:52724622-52724644 CCAGCGGAGCTACCCGGCTCTGG - Intergenic
1069744318 10:70705375-70705397 CCCACGGAGAGCCCGAGCTCGGG - Intronic
1071527322 10:86366208-86366230 CCCGCCGAGCCCCTCGGCCCAGG + Intronic
1073325959 10:102644107-102644129 GCCCCGCAGACCCCGGGCTCCGG + Intergenic
1075901130 10:126043533-126043555 CCCGCGGTGCCCCAGGGCTCTGG - Intronic
1077386099 11:2270245-2270267 CCGGCGGAGACCCGCGTCCCCGG - Exonic
1078474640 11:11620585-11620607 CCCGCGGAGCCGCCCGGGACCGG - Intronic
1079126446 11:17721246-17721268 CCCGCGCAGAACCCAGGCCCGGG + Exonic
1082004096 11:47410205-47410227 CCGTCGCAGTCCCCCGGCTCCGG - Exonic
1083159817 11:60848117-60848139 CCCGTGGAGGCCCTCGCCTCAGG - Intronic
1083728883 11:64642749-64642771 CCCGCGCCGCCCCCCGGCCCTGG - Intronic
1084151261 11:67289034-67289056 CCTGCGCAGACCCCCGGAGCCGG - Intronic
1084156903 11:67318167-67318189 CGCGCGCAGGCCCTCGGCTCGGG - Intronic
1084329734 11:68423414-68423436 CTGGCGGAGACCCCTGGCACTGG - Intronic
1084568231 11:69943697-69943719 TCCTCGGAGACTCCCGGCACTGG - Intergenic
1096154938 12:49336576-49336598 CCCGCGGAGAGCCCCGGCCCCGG - Exonic
1096598746 12:52714636-52714658 CCCGGGAAGACCTGCGGCTCGGG - Intergenic
1096777592 12:53973737-53973759 CCCGCCGAGCCCCCCTGCTCCGG + Exonic
1099315493 12:81078155-81078177 CCCTCCGAGCCCCCCGGCGCTGG - Exonic
1103595309 12:122021701-122021723 CGCACGGCGACCCCCGGCTCTGG - Exonic
1104841660 12:131828691-131828713 CCCGCGGAGACCCCCGGCTCCGG - Intronic
1112374460 13:98825827-98825849 CCCCCGGGGACCCCCTGCCCTGG - Intronic
1113379362 13:109787535-109787557 CCCGCGCGGTCTCCCGGCTCAGG - Intergenic
1113812940 13:113153398-113153420 CCAGCGGAGACCGGCGGCTGGGG - Intergenic
1114485247 14:23057924-23057946 ACTGCGGAGAGACCCGGCTCCGG + Intergenic
1117240775 14:53830059-53830081 CCAGCGGAGCTCCCAGGCTCTGG - Intergenic
1117791947 14:59350653-59350675 CCCGCAGTGTCCCCTGGCTCCGG - Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1119266278 14:73264770-73264792 TCCACTGAGACCCCCGGCCCTGG - Intronic
1119451261 14:74712932-74712954 CGCGCTGCAACCCCCGGCTCGGG - Exonic
1119480513 14:74955255-74955277 CCCTCGGAGCCCCCTGGCTCGGG - Exonic
1129410547 15:75348204-75348226 CCCGCGGCCGCCCCCGGGTCAGG - Intronic
1132540917 16:509309-509331 CTCGCGGAGGCCGCTGGCTCGGG + Intronic
1132766257 16:1535900-1535922 CACGCGGAGACCCAAGCCTCGGG - Intronic
1133298443 16:4767054-4767076 CCCGCCGAGACCCGCCGCTCCGG - Exonic
1133325111 16:4937325-4937347 CCTCCGGAGTCCCCCGGCTGGGG - Intronic
1134849811 16:17470656-17470678 CCCGCGGCGCTCCCCGGCCCCGG + Exonic
1137690929 16:50427014-50427036 CCCGGTGAGACCCCTGGCACCGG - Intergenic
1142523249 17:519600-519622 CCCGCTGAGACCACCTGCACAGG - Intronic
1147316297 17:39621994-39622016 CACCTGGAGACCCCCTGCTCTGG - Intergenic
1147393071 17:40122082-40122104 GCCGCGGAGACCCCCGGGAGAGG + Intergenic
1150217012 17:63476694-63476716 CCCCCGGAGCCTCCCGCCTCCGG - Intergenic
1151370784 17:73645036-73645058 CCGGCGGGCAGCCCCGGCTCCGG + Intergenic
1152426400 17:80220721-80220743 CCTCCGGAGACCCCAGGATCCGG + Intronic
1152479643 17:80541863-80541885 CCCGAGTGGACCCCTGGCTCGGG + Intergenic
1152758934 17:82098400-82098422 CCCGCGCAGGGTCCCGGCTCGGG - Intergenic
1152795073 17:82302663-82302685 CTGGCTGAGACCCCGGGCTCTGG - Intergenic
1154324698 18:13381491-13381513 CCCGTGGTGACTCCCGGCCCTGG - Intronic
1156231004 18:35153889-35153911 CAAGAGGAGACCCCAGGCTCTGG + Intergenic
1156250109 18:35344359-35344381 CCGGCGCAAACCTCCGGCTCAGG + Exonic
1159947632 18:74456504-74456526 ACCGCGGAGAGCCTGGGCTCTGG + Intronic
1160691864 19:463992-464014 CTGGAGGAGACCCCCGGCCCTGG - Exonic
1160992370 19:1864935-1864957 CCTGCGGCGACCTCCTGCTCTGG + Intergenic
1161011308 19:1960525-1960547 CACACGGAGACCCCAGGCGCAGG - Intronic
1161108666 19:2456538-2456560 CCCGCGGAAACCCCCGAAGCCGG + Intronic
1161265098 19:3360141-3360163 CCCGCGGGGTGCCCCGGCCCGGG + Intronic
1161304152 19:3557599-3557621 CCGGCGCAGTCGCCCGGCTCTGG - Intronic
1161350619 19:3789435-3789457 CCCGAGGAGCCCCAGGGCTCCGG + Intronic
1161397871 19:4054349-4054371 CCCGGAGAGTCGCCCGGCTCGGG + Exonic
1162128519 19:8511851-8511873 CCCGCCGCCACCCCCGGCCCTGG - Exonic
1162312238 19:9914148-9914170 CGCGCGGGGTCCCGCGGCTCAGG - Intronic
1162643975 19:12035430-12035452 CCCGCGGCGACTCCGGGGTCTGG - Intronic
1164759723 19:30719777-30719799 CCCGCTGCGGCCTCCGGCTCTGG + Intergenic
1165157342 19:33796487-33796509 CGCGCGGCGACTCCTGGCTCGGG - Intronic
1167501561 19:49851360-49851382 CCCGAGGGGGCCCCCGGCGCCGG - Exonic
1168240092 19:55084545-55084567 CCTGCTGAGACCCTCTGCTCGGG - Intronic
1168604412 19:57747070-57747092 CGCGCTGAGGCCCCCGGCTCAGG + Exonic
1168628167 19:57935160-57935182 CGCGCTGAGGCTCCCGGCTCAGG - Exonic
928378815 2:30801121-30801143 CCCAGGCAGACCCTCGGCTCCGG + Intronic
929452903 2:42048411-42048433 CCCGCGGGGGCCCCGGGCCCGGG + Exonic
931747147 2:65300350-65300372 CCCTCGGGGACTCCCAGCTCTGG + Intergenic
935046832 2:99490138-99490160 CCCGGGGCGACCCCAGCCTCGGG + Intergenic
937217494 2:120321906-120321928 CCCAGGAAGGCCCCCGGCTCAGG - Intergenic
1169048666 20:2558562-2558584 TCCGGGGAGACCCCGGGCTTGGG - Exonic
1169345091 20:4823102-4823124 CCCCGGGAGCCCCGCGGCTCGGG + Intronic
1172764823 20:37345916-37345938 CCCGCCCGGACCCCCAGCTCGGG + Intronic
1174121595 20:48269783-48269805 CCCCCGCAGACCCCATGCTCTGG - Intergenic
1174393806 20:50233897-50233919 CCCCCAGAGACCCCCAGGTCCGG - Intergenic
1175562312 20:59940452-59940474 CGCGCGGGGACGCCCGGCTGCGG - Intronic
1176205822 20:63887632-63887654 CCACCAGAGACACCCGGCTCTGG - Intronic
1178958525 21:37043983-37044005 CCCAAGGAGTCCCACGGCTCAGG + Intergenic
1179605616 21:42513739-42513761 GCCGCCGCGACCCCCGGCTCCGG - Intronic
1180087840 21:45516023-45516045 CCCGCGGCAGCCCCCGGCCCAGG - Exonic
1180143737 21:45908552-45908574 CCCCAGGACACCCCCAGCTCTGG - Intronic
1180245752 21:46546170-46546192 ACCCCGGGGACCCCCGACTCAGG - Intronic
1180746892 22:18095512-18095534 CCGGCGGGCACCCCCTGCTCTGG + Exonic
1181085165 22:20436488-20436510 CCCGCTGCGAGCCCCGCCTCCGG - Intronic
1182309341 22:29393602-29393624 CCCTCTGAGACCCCAGGCCCAGG + Intronic
1183739743 22:39662998-39663020 CCCCTGGAGACCCCCACCTCTGG - Intronic
1184033989 22:41910076-41910098 CCCGCGGCAACCCCCGGCGCGGG - Exonic
1185068037 22:48641708-48641730 CCCTCGGAGGCCCCCGGTCCAGG + Intronic
952827771 3:37538326-37538348 CCCGAGGAGCCCCCCTGCACGGG - Intronic
961222846 3:125213210-125213232 CACACGGAGACCCCCGGTACCGG - Intergenic
968571912 4:1346618-1346640 CCCGCGGCGCCTCCCCGCTCCGG - Intergenic
968584663 4:1410620-1410642 CCCCCGGAGGCCACGGGCTCGGG + Intergenic
969476375 4:7424685-7424707 CCTGCTGAGAGCCCCGGCACAGG - Intronic
969580363 4:8061214-8061236 CCCGGGGGCACCCCCGGGTCTGG - Intronic
969602143 4:8182823-8182845 CCCTCTGAGACCCCTGGCACTGG - Intronic
969714490 4:8861678-8861700 CCCGAGGAGGCCCACAGCTCTGG + Intronic
975778938 4:77819549-77819571 CCCCCCGAGACCCCGGGCCCGGG - Intronic
978384752 4:108168140-108168162 CGCGCGGAGAACGCCGGTTCTGG + Exonic
991113184 5:62924954-62924976 CCAGCTGAGACCCCAGGCTCTGG - Intergenic
997926169 5:138032962-138032984 CCCCCGGATACCCCCGGCGGTGG + Exonic
998114237 5:139524275-139524297 CCAGCCTAGACCCCCAGCTCAGG + Intergenic
1001993324 5:176134636-176134658 CCCGGGGGCACCCCAGGCTCAGG - Intergenic
1002455464 5:179343842-179343864 CCCGCGTGGAGCCCCTGCTCGGG - Exonic
1002862791 6:1095002-1095024 CTCCAGGAGACCCTCGGCTCAGG - Intergenic
1005926685 6:30451134-30451156 CCAGCGGTGGCCCCGGGCTCAGG + Intergenic
1013273096 6:108560530-108560552 CCCGCGCAGTCCCCGGGCTCGGG + Intronic
1015910107 6:138161628-138161650 CCCGCGGCCACCGTCGGCTCAGG + Intergenic
1017842243 6:158231917-158231939 CCCCGGGAGACCCCCGCCCCCGG - Intergenic
1018370726 6:163165539-163165561 CCTGTGGAGACCCCTGTCTCAGG + Intronic
1018699120 6:166412942-166412964 CCCATGGAGGCCCCGGGCTCCGG - Intronic
1019309917 7:354958-354980 CCCCCAGAGACCCCTGGCACAGG - Intergenic
1019997278 7:4732817-4732839 GCAGCGCAGACCCGCGGCTCCGG - Intronic
1020000710 7:4754094-4754116 CCCGCGGAGGCTACCTGCTCCGG + Intronic
1022092352 7:27115787-27115809 CCCGCTGAGGCCCGCGGCCCAGG - Intronic
1023064816 7:36366954-36366976 CCCGCGGAGCCCGCCGCCCCGGG - Intronic
1024797387 7:53035936-53035958 CCCTCGGAGACCACCCGCTGCGG - Exonic
1027237494 7:76306708-76306730 CCAGCAGAGACCCCCAGATCTGG - Intergenic
1029121221 7:98269664-98269686 CCCTCAGAGACCCCCACCTCAGG - Intronic
1032119324 7:129144983-129145005 GGCGCGGAGACCCCGGGCGCCGG + Exonic
1034672820 7:152870889-152870911 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672832 7:152870941-152870963 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672844 7:152870993-152871015 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034672856 7:152871045-152871067 GCTGCAGAGACCCCCGGCTCTGG - Intergenic
1034759408 7:153657374-153657396 CCCGCTGAGACCCCATTCTCAGG + Intergenic
1034902617 7:154916639-154916661 CCCCAGGAGAGTCCCGGCTCGGG + Intergenic
1036683932 8:10895702-10895724 CCCGAGGGGACCCCCGAGTCAGG + Intergenic
1037569577 8:20147269-20147291 CCTGCGGAGCCCCCCGGCAAAGG - Exonic
1038429638 8:27490046-27490068 CCAGAGGAAACCCACGGCTCTGG + Intergenic
1038575575 8:28701354-28701376 TCCGCGGTGACACCCGGGTCAGG - Exonic
1039467960 8:37797235-37797257 CCCGCGGGGACCCACAGCGCTGG - Exonic
1039512816 8:38105356-38105378 CCCGCGGCCACCGCCGGCGCGGG + Exonic
1040284854 8:46094459-46094481 CACGGGGAGACCCCCGGGTAGGG + Intergenic
1049022197 8:139965093-139965115 CCCCCAGAGACCCCCTGCTGAGG - Intronic
1049113075 8:140661733-140661755 CCCCTTGAGACCCCCTGCTCTGG - Intronic
1049850273 8:144826999-144827021 CTCGCGGAGACGCCTGGCTCGGG - Intergenic
1051626238 9:19102469-19102491 CCCCCGGCGTCCCCCGGTTCAGG + Intronic
1055641723 9:78324091-78324113 CCCTCGGAGACACGCTGCTCAGG - Intronic
1056443846 9:86645579-86645601 ACCGCGGAGGGCCCTGGCTCTGG + Intergenic
1058885849 9:109320725-109320747 CCCGCGCAGGCCGCCGGCCCGGG - Exonic
1062243124 9:135550281-135550303 CCCACTGAGACCCCCGGGGCGGG - Intergenic
1062425009 9:136502138-136502160 CCCCCAGAGACCCCTGGCCCGGG + Intronic
1062461939 9:136665889-136665911 CCCGCGGAGCCCCCGGGGGCGGG + Intronic
1185464203 X:345693-345715 CCCGCAGAGGCCCCGCGCTCAGG - Intronic
1200073901 X:153541992-153542014 CCAGAGGAGACCCCCAGCACAGG + Intronic
1200277852 X:154751143-154751165 GCCGCTGCGACCCCCGCCTCCGG + Intronic