ID: 1104842235

View in Genome Browser
Species Human (GRCh38)
Location 12:131830631-131830653
Sequence CGCCGGAGGCGCTCCCGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 97}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104842225_1104842235 18 Left 1104842225 12:131830590-131830612 CCGGGATCTGGGCGGGAGCGGGG 0: 1
1: 0
2: 1
3: 33
4: 377
Right 1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG 0: 1
1: 0
2: 2
3: 5
4: 97
1104842228_1104842235 -8 Left 1104842228 12:131830616-131830638 CCTCCTCCGCCCGCTCGCCGGAG 0: 1
1: 0
2: 3
3: 25
4: 193
Right 1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG 0: 1
1: 0
2: 2
3: 5
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104842235 Original CRISPR CGCCGGAGGCGCTCCCGGAG TGG Intronic
900658607 1:3772295-3772317 CGTCGGAGGGGCTCCAGCAGGGG + Intergenic
903078036 1:20787086-20787108 CGCCGACGCCGCTCCCAGAGAGG - Intronic
903740129 1:25553946-25553968 CGCGGGAGACGCTGCTGGAGGGG + Exonic
903867895 1:26411791-26411813 AGCCGGAGGGGTTCCCGGAAGGG - Intronic
906640473 1:47438078-47438100 AGCCCGAGCCGCTGCCGGAGCGG + Exonic
913162295 1:116155203-116155225 CGATGGAGGCGCTCTTGGAGTGG + Intergenic
913191742 1:116418748-116418770 AGCCGGGCGCGCTCCCGGCGGGG - Intergenic
914919542 1:151838221-151838243 CGCCGCCGCCGCTCCCGGGGCGG + Exonic
916651747 1:166839823-166839845 CAGCGGAAGCGCTCCCGGCGCGG + Intronic
917522210 1:175757564-175757586 CTCTGGAGGCGCTCTTGGAGCGG - Intergenic
917920004 1:179743386-179743408 CGCGGGAGTCGCTGCCCGAGCGG + Exonic
917975267 1:180233937-180233959 CCCCGGAGGAGCCCCAGGAGAGG - Intronic
1063130292 10:3172458-3172480 TGCCCGCGGCGCTCCCGGCGGGG - Intronic
1063450020 10:6144973-6144995 CGCCGGGGGCGCTCCCCGCGGGG - Intronic
1063957318 10:11279445-11279467 AATTGGAGGCGCTCCCGGAGTGG + Intronic
1070570766 10:77638094-77638116 CGCGGGAGGCGCTCGGGGAAGGG - Intronic
1072656762 10:97335005-97335027 CCCAGGAGGCGGGCCCGGAGTGG - Intergenic
1076879103 10:133231216-133231238 CGACGGGGGCGCGGCCGGAGGGG - Exonic
1079076658 11:17388933-17388955 CGGCGGGGGCGCTCCGGGAGGGG - Intronic
1079229121 11:18634374-18634396 CGCCGGAAGTGGTCCCGCAGAGG - Exonic
1091762453 12:3096041-3096063 CCCGGGCGGCGCTCCCGGCGCGG + Intronic
1092163658 12:6329703-6329725 CGCGGGAGGCGCTCCCAGAGGGG - Intronic
1097267563 12:57755063-57755085 CGGCGGAGACCCCCCCGGAGTGG - Intronic
1098104507 12:67055279-67055301 TGCTGGAGCCGCTCCTGGAGTGG + Intergenic
1099365148 12:81758964-81758986 CTCCAGAGGGGCTCCAGGAGGGG - Intronic
1103413032 12:120726036-120726058 GGCCGTGAGCGCTCCCGGAGTGG - Intronic
1103534759 12:121626824-121626846 CGCCGGAGCCGCCGCCGCAGCGG + Exonic
1103721693 12:122978795-122978817 TGCAGGAAGCGCTCCCGCAGTGG - Exonic
1104842235 12:131830631-131830653 CGCCGGAGGCGCTCCCGGAGTGG + Intronic
1111333501 13:86792152-86792174 CGCCGCAAGCGCTGCCAGAGTGG - Intergenic
1113768405 13:112894506-112894528 CGTCGCGGTCGCTCCCGGAGCGG + Intronic
1113962013 13:114131524-114131546 TCCCGGAGGCGTTTCCGGAGAGG - Intronic
1114477813 14:23010182-23010204 CCCCGGACGCCCTCCCGGATTGG + Intergenic
1114866202 14:26598007-26598029 CGCCGCCGCCGCTGCCGGAGCGG + Intergenic
1115490203 14:33951133-33951155 TCCCGGAGGCGGTCCCGGGGCGG - Intronic
1118711223 14:68521185-68521207 CGAAGGAGGCACTCCCAGAGAGG + Intronic
1120186212 14:81396113-81396135 CCCCGGAGGAGCTCTCGGACTGG + Exonic
1121001441 14:90454434-90454456 CGCCGCAGGTTCTCCCGCAGAGG - Intergenic
1122480899 14:102046654-102046676 CTCGAGAGGCGCTCCAGGAGGGG - Intronic
1122635354 14:103127197-103127219 CGCTGGAGGCGCCGCCCGAGCGG + Exonic
1125510726 15:40291140-40291162 CGCCGGAGCCGCGCCGGGCGAGG - Exonic
1126113266 15:45187688-45187710 CGCGGGGGGCGCGGCCGGAGAGG + Intronic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132252046 15:100341562-100341584 CGCCGGAGACCCTCCCCGGGTGG - Intronic
1132499876 16:280555-280577 CGCGGGGGGCGCTCCCGGCCGGG + Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1136365558 16:29807544-29807566 CGGCGGCGGCGCTGCCGCAGTGG + Exonic
1138106431 16:54289429-54289451 CGCCGGATGCGCACCGGGAACGG + Intergenic
1138594642 16:58023312-58023334 CGCCCGAGGGGCCCCTGGAGGGG + Intergenic
1145218909 17:21072800-21072822 GGCCGCAGGAGCTGCCGGAGTGG - Intergenic
1148542628 17:48492618-48492640 GGACGAAGGCGCGCCCGGAGAGG + Intergenic
1149997403 17:61412236-61412258 CCCCGAAGGCGCTCCCGGGAGGG - Exonic
1150675812 17:67245275-67245297 GGCGGGAGGCGCGGCCGGAGGGG - Intronic
1151452127 17:74204239-74204261 CGGGGAAGACGCTCCCGGAGCGG - Intronic
1152570121 17:81118013-81118035 CACCGGAGGAGCTGCCGGATGGG + Exonic
1152729165 17:81961386-81961408 CGCCGGAGGCGCTCCCGGCCCGG + Intronic
1156448562 18:37253981-37254003 CGCCCGGGGCGCTGCCGGCGGGG + Intronic
1160592208 18:79951192-79951214 GTCCCGAGACGCTCCCGGAGGGG + Intronic
1163329434 19:16627504-16627526 CCCGGGAAGCCCTCCCGGAGCGG - Intronic
1166529333 19:43533392-43533414 CGCCGGACGCGCGCCGGGCGGGG + Exonic
934946232 2:98543911-98543933 CGCCGGAGGCTCTCCCAGCAAGG - Exonic
940883316 2:158968509-158968531 CGCGGGAGGCGCGGCCGGGGCGG + Intergenic
941772762 2:169362182-169362204 CGCGGGAGCTGCTCCCGGTGGGG - Intronic
948843766 2:240673100-240673122 CGCCAGGCGCGTTCCCGGAGTGG + Intergenic
1169204526 20:3732483-3732505 CGCAGGAGGGGCTCAGGGAGGGG + Intergenic
1169316200 20:4592760-4592782 AGCCGGCGGCGTTCCCGGCGTGG - Intergenic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1178948504 21:36966939-36966961 CGCCGGGGCTGCACCCGGAGAGG + Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1179959198 21:44758832-44758854 CGCGGCAGGCGCCCCAGGAGTGG + Intergenic
1183484347 22:38081380-38081402 CGCCGGGGACGCTCCGGGCGAGG - Exonic
950940145 3:16884267-16884289 CCCCGGGGCAGCTCCCGGAGGGG - Intronic
954152121 3:48662795-48662817 CGCCGGAGGGGCTCCGGCCGCGG - Exonic
954401327 3:50321287-50321309 CCCCGGGGGTGCTCGCGGAGAGG - Exonic
956681481 3:71785350-71785372 CGCAGGCAGCGCTCCCGGCGGGG + Intergenic
958980131 3:100709998-100710020 CGCCTGGGGGGCTCCGGGAGGGG + Intronic
961202436 3:125055667-125055689 GGCCCGCGGCGCTCCCGGGGCGG + Exonic
963236740 3:142963700-142963722 CGCCGCCGCCGCCCCCGGAGCGG + Intergenic
967316286 3:188154320-188154342 CCCCGGAGGCGCTCGCGCCGGGG - Intronic
968562214 4:1290054-1290076 CGCCGCTGGCCCTCCCGGGGCGG - Intronic
976431294 4:84966163-84966185 CGCCCCCCGCGCTCCCGGAGAGG - Intronic
992460270 5:76953838-76953860 CCGCGGAGGCGCGCCAGGAGCGG + Intronic
1002351987 5:178589908-178589930 CGCAGCAGGCGCTCCAGGTGCGG + Exonic
1002520927 5:179792985-179793007 GGCCGGGGGCGCTCCAGGCGGGG + Intronic
1015244770 6:131063325-131063347 CGCCGGACGAGCCCCCGGCGCGG + Intergenic
1019446298 7:1073375-1073397 CGCCGGAGGAGCTGCCTGCGCGG - Intronic
1019537522 7:1537074-1537096 AGCCGGGGGCGCCCCAGGAGGGG - Intronic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1026360859 7:69599717-69599739 CGGGAGAGGCGCTCCCGGGGCGG + Exonic
1027232655 7:76281710-76281732 TGCCGGAGTCGCTGCTGGAGCGG - Exonic
1032151810 7:129435131-129435153 CGCGGAAGGCGCTCCCGAAACGG - Intronic
1032239998 7:130153244-130153266 CGCCGGAGCCACTCCCAGTGGGG - Intergenic
1032298772 7:130668325-130668347 CGCCGGAGGCCCGCGCGCAGGGG + Intronic
1038933441 8:32220740-32220762 CCGCGGAGGAGCTCCGGGAGGGG - Intronic
1041719560 8:60964026-60964048 CCCAGGAGCCGCTGCCGGAGTGG + Intergenic
1048484191 8:134832065-134832087 AGCCCGAGGCGCGCCTGGAGCGG + Intergenic
1049585398 8:143430491-143430513 CGCGGGCGGCGGTCCCGGCGGGG + Intergenic
1049973542 9:841695-841717 AGCCGGAGGCGCAGCTGGAGTGG - Exonic
1052824880 9:33167347-33167369 CGCCCGAGGCGCCGGCGGAGAGG + Exonic
1057322816 9:94030443-94030465 CACAGGAAGCGCGCCCGGAGAGG + Intergenic
1060629569 9:125143450-125143472 CGCCGGAGCAGCTCCCGCGGCGG - Exonic
1062676933 9:137752194-137752216 CGCCGGAGACGCTCGCGGGGCGG - Intronic
1062696206 9:137877633-137877655 CGAGGGAGGCGCAGCCGGAGGGG + Intergenic
1200787545 Y:7273745-7273767 CGCCCGGGGCGCCCCCGGGGTGG - Intergenic
1201904748 Y:19077125-19077147 CCCCGGCGGCGCTACCGCAGCGG + Intergenic