ID: 1104843668

View in Genome Browser
Species Human (GRCh38)
Location 12:131836163-131836185
Sequence TGGGTCAGTAGGGTTTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 192}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104843651_1104843668 26 Left 1104843651 12:131836114-131836136 CCAGTTCTGTACACACTCTTGGC 0: 1
1: 0
2: 0
3: 11
4: 114
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192
1104843661_1104843668 0 Left 1104843661 12:131836140-131836162 CCCAAGGGGCTGAGGGGCTGGGC 0: 1
1: 0
2: 3
3: 56
4: 402
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192
1104843649_1104843668 27 Left 1104843649 12:131836113-131836135 CCCAGTTCTGTACACACTCTTGG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192
1104843647_1104843668 29 Left 1104843647 12:131836111-131836133 CCCCCAGTTCTGTACACACTCTT 0: 1
1: 0
2: 1
3: 31
4: 315
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192
1104843659_1104843668 1 Left 1104843659 12:131836139-131836161 CCCCAAGGGGCTGAGGGGCTGGG 0: 1
1: 0
2: 3
3: 59
4: 468
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192
1104843662_1104843668 -1 Left 1104843662 12:131836141-131836163 CCAAGGGGCTGAGGGGCTGGGCT 0: 2
1: 0
2: 7
3: 72
4: 509
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192
1104843648_1104843668 28 Left 1104843648 12:131836112-131836134 CCCCAGTTCTGTACACACTCTTG 0: 1
1: 0
2: 1
3: 18
4: 161
Right 1104843668 12:131836163-131836185 TGGGTCAGTAGGGTTTGGAAAGG 0: 1
1: 0
2: 1
3: 18
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104843668 Original CRISPR TGGGTCAGTAGGGTTTGGAA AGG Intronic