ID: 1104845293

View in Genome Browser
Species Human (GRCh38)
Location 12:131843923-131843945
Sequence CAGAAGGGCTGGTGGGATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 3, 3: 58, 4: 337}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104845284_1104845293 -1 Left 1104845284 12:131843901-131843923 CCTCGGTTTCATCCCTGGGATTC 0: 1
1: 0
2: 1
3: 7
4: 133
Right 1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG 0: 1
1: 1
2: 3
3: 58
4: 337
1104845277_1104845293 24 Left 1104845277 12:131843876-131843898 CCCACAGAGCCTGTCTGCTGAGT 0: 1
1: 0
2: 1
3: 18
4: 191
Right 1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG 0: 1
1: 1
2: 3
3: 58
4: 337
1104845281_1104845293 15 Left 1104845281 12:131843885-131843907 CCTGTCTGCTGAGTGGCCTCGGT 0: 1
1: 0
2: 2
3: 10
4: 151
Right 1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG 0: 1
1: 1
2: 3
3: 58
4: 337
1104845275_1104845293 26 Left 1104845275 12:131843874-131843896 CCCCCACAGAGCCTGTCTGCTGA 0: 1
1: 0
2: 1
3: 26
4: 261
Right 1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG 0: 1
1: 1
2: 3
3: 58
4: 337
1104845278_1104845293 23 Left 1104845278 12:131843877-131843899 CCACAGAGCCTGTCTGCTGAGTG 0: 1
1: 0
2: 1
3: 22
4: 286
Right 1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG 0: 1
1: 1
2: 3
3: 58
4: 337
1104845276_1104845293 25 Left 1104845276 12:131843875-131843897 CCCCACAGAGCCTGTCTGCTGAG 0: 1
1: 0
2: 6
3: 29
4: 314
Right 1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG 0: 1
1: 1
2: 3
3: 58
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104845293 Original CRISPR CAGAAGGGCTGGTGGGATGT GGG Intronic
901004782 1:6166421-6166443 GAGAAGGGCCGGTAGGAGGTGGG + Intronic
901170324 1:7252437-7252459 CAGAAATGCTGGTGAGATGTGGG - Intronic
901222762 1:7593025-7593047 CATAATGGCTTTTGGGATGTAGG - Intronic
901435190 1:9243190-9243212 CAGAGGGGGTGGTGGGAGGAGGG + Intronic
901773999 1:11546671-11546693 CAGAGGGGCTGGTGGGCCATGGG + Intergenic
902064674 1:13674553-13674575 CAGGAGGGGCTGTGGGATGTTGG - Intergenic
902513319 1:16977562-16977584 CAGGAGGGCTGGTGGGCTGGAGG - Intronic
902558463 1:17260909-17260931 CATGATGGCTGGTGGGATGGAGG + Intronic
903070419 1:20724396-20724418 CAGAGGGGCTGGTGGGCAGTGGG - Exonic
903262730 1:22140031-22140053 CAGAAGGGCAGGTGGCCTGGTGG - Intronic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904906069 1:33898201-33898223 CAGATGGGCTGTTGGGGAGTGGG - Intronic
905538860 1:38744523-38744545 CAAAAGGGCTGGAGGGAACTAGG + Intergenic
906381048 1:45332379-45332401 CAGCAGCTCTGGTAGGATGTTGG - Exonic
906885229 1:49638154-49638176 AAAATGGGCTGTTGGGATGTTGG - Intronic
908602095 1:65751519-65751541 CAGAAGGGCACAGGGGATGTAGG - Intergenic
908611763 1:65868918-65868940 CAGACGGGGTGGTGGGAGGGAGG - Intronic
911251080 1:95576943-95576965 CATAAGAGCTGATGAGATGTGGG - Intergenic
912370765 1:109172406-109172428 CTGGAGGGCTGGTGCAATGTGGG + Intronic
912708151 1:111930093-111930115 TAGAAGGGCTGCTGGAATGCGGG + Intronic
912985248 1:114421513-114421535 CAGATGGGCTGGTGGGACCTCGG + Exonic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916450228 1:164913622-164913644 CAGAAAGCATGGTGGGATGGAGG + Intergenic
917469979 1:175318180-175318202 CAGAAGCTCTGGTGGGAGGCTGG + Exonic
918207506 1:182322747-182322769 CAGAAGGTGTAGTGGGATGAGGG + Intergenic
920232813 1:204481763-204481785 CAGAAGGCCTGGGGGCATTTGGG - Intronic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
922721209 1:227901216-227901238 CAGGAGGGCTGGTGGGGCGGGGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
923570552 1:235109518-235109540 CAGAATGGCAGGTGGGAGGATGG + Exonic
1062797929 10:358591-358613 AAGAAGGGGGGGTGGGAGGTGGG + Intronic
1063085338 10:2812918-2812940 CAGGAGGACTGATGTGATGTGGG - Intergenic
1064158334 10:12922357-12922379 CAGATGGGAGGGTGGGATGCAGG - Intronic
1067806233 10:49395320-49395342 CAGCAGGGCTGGTGGGTGGCTGG - Intronic
1068951180 10:62779149-62779171 CACAAGGGCTCGAGGGAAGTTGG + Intergenic
1069688448 10:70334391-70334413 CAGAAAGGCTGTTGGGGTGTTGG - Intronic
1070259184 10:74837698-74837720 CAGTGGGGCCAGTGGGATGTTGG + Intronic
1070757937 10:79005093-79005115 CAAAAGGGCAGGTAGGATGTGGG + Intergenic
1071368505 10:84926786-84926808 CAGAAGAGCGGGTGTGTTGTGGG + Intergenic
1071450181 10:85786578-85786600 CAGCAGGGTGGGAGGGATGTCGG - Intronic
1072813867 10:98485886-98485908 CAGAAGAGAAGGTGGGATGTGGG + Intronic
1075076261 10:119352704-119352726 CAGAAGGGTTGATGAGATGGTGG - Intronic
1076818274 10:132925300-132925322 CAGCAGGGCTTGTGGGAGGTGGG - Intronic
1078886911 11:15509278-15509300 CAGAAGTGTAGGTGGAATGTGGG - Intergenic
1079330335 11:19527829-19527851 TAGGAGTGCTGGTGGGAGGTGGG - Intronic
1080139693 11:28901790-28901812 GAAAAGGGCAGGTGGGATCTGGG - Intergenic
1082267002 11:50129948-50129970 CAGCAGGGGTGGTGGGGTTTGGG + Intergenic
1082289087 11:50348620-50348642 CAGCAGGGGTGGTGGGGTTTGGG - Intergenic
1083202658 11:61129890-61129912 CTGCCGGGCTGGCGGGATGTCGG - Intergenic
1083725075 11:64623663-64623685 CAGAAGGCCTGGTTGTAGGTGGG - Intronic
1084010593 11:66346434-66346456 CAGGAGGGGTGGTGGGATCAGGG - Intronic
1084569282 11:69949743-69949765 CAGAAGGGCTGGAAGGAGGCAGG + Intergenic
1084777773 11:71388671-71388693 CATTAGGACTGTTGGGATGTTGG - Intergenic
1085313615 11:75530489-75530511 CTGGAGAGCTGGTTGGATGTAGG + Intergenic
1085318022 11:75557768-75557790 CTGAAGGGCTGGTGGGATGGAGG - Intergenic
1085390016 11:76177530-76177552 CCGAGGGGCTGGGGGGCTGTGGG - Intergenic
1086335472 11:85796633-85796655 CAGAGGAGCTGGGAGGATGTGGG - Intronic
1086340025 11:85839385-85839407 CAGATGTGCTGCTGGGAGGTGGG - Intergenic
1089679135 11:120109796-120109818 GAGGCTGGCTGGTGGGATGTTGG - Intergenic
1089682488 11:120126703-120126725 GAGAAGGGCAGGTGGGCTGGAGG - Intronic
1090343265 11:126044740-126044762 CAGAAGGGCAGCAGGGAGGTGGG + Intronic
1090660038 11:128875644-128875666 CAGAAGGGCAGGTGGGAACAAGG + Intergenic
1091086187 11:132724165-132724187 AAGAAGGGGTGGTGGGAGGTGGG - Intronic
1091388950 12:113522-113544 CACACGGCCTGGTGGGATCTTGG + Intronic
1091459198 12:631040-631062 CAGAAAGGTTGGTGGGGAGTGGG + Intronic
1091583123 12:1800601-1800623 CTGCAGGGCAGGTGGGAGGTGGG - Intronic
1091711474 12:2743594-2743616 CAGCCTAGCTGGTGGGATGTGGG + Intergenic
1092727517 12:11500005-11500027 CTGCAGGTCTGGTGGGATGTGGG - Intronic
1094524537 12:31222914-31222936 CTGCAGGTCTGGTGGGATGACGG + Intergenic
1094722029 12:33075348-33075370 CAGAGGCGCAGGTGGGATCTGGG + Intergenic
1095399525 12:41798721-41798743 CACAAAGCCTGGTGCGATGTAGG - Intergenic
1095527394 12:43143620-43143642 GAGGAGGACTTGTGGGATGTTGG - Intergenic
1096480063 12:51934216-51934238 CAGAGTGGCTGGAGGGGTGTGGG - Intergenic
1097066629 12:56325301-56325323 CATCAGGGCCTGTGGGATGTGGG - Intronic
1100452713 12:94722783-94722805 GAGAAGGGCTGGTAGGAACTAGG - Intergenic
1101813297 12:108126485-108126507 CAGATGGGCTGGGGGGATGCTGG + Intergenic
1102798947 12:115714836-115714858 AAGAGAGGGTGGTGGGATGTCGG - Intergenic
1102990700 12:117313794-117313816 GAGAAAGGCTGTTGGGAAGTAGG - Intronic
1103624262 12:122206426-122206448 CAGAAAGGCTGGTGGGCCGTGGG - Exonic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1105997636 13:25687496-25687518 GGGAAGGCCTGCTGGGATGTGGG - Intronic
1106388499 13:29312044-29312066 CAGTGGGGTTGGAGGGATGTGGG - Intronic
1108071551 13:46634238-46634260 AAGAAGAGCTGGTGGCATCTGGG - Intronic
1108157684 13:47603306-47603328 TTGAAAAGCTGGTGGGATGTAGG + Intergenic
1109328540 13:60899974-60899996 TTGAAGGGGTGCTGGGATGTAGG + Intergenic
1112025989 13:95411672-95411694 CAGAAGGGCGGGTGGGAGCCAGG - Intergenic
1112566205 13:100553012-100553034 CAGAGGGGACGGTGGGCTGTTGG + Intronic
1113903272 13:113807806-113807828 CAGGAGGGCTTACGGGATGTGGG + Intronic
1116303780 14:43221692-43221714 CAGTAGGGATGGTGGGAGGAGGG - Intergenic
1116861746 14:50001122-50001144 CTGCAGGGCTGGTGGGCTCTGGG - Intronic
1118047259 14:61984147-61984169 CAGAAGGGGTGGAGGCATTTGGG - Intergenic
1118476313 14:66120710-66120732 CAGAGGGGTGGGTGGGATGGGGG + Intergenic
1119806900 14:77487992-77488014 CAGAAGGGCTGAGGGGATCAGGG + Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122891499 14:104734201-104734223 CAGGTGGGCTGGTGGCATGATGG - Intronic
1123004892 14:105316406-105316428 GAGAAGGGCTGTGGGGCTGTGGG - Intronic
1123067952 14:105627717-105627739 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123091633 14:105744718-105744740 CAGCAGGGCCGGTGGGAGGCAGG - Intergenic
1123091968 14:105745938-105745960 CAGCATGGCTGGTGGGAGGTGGG - Intergenic
1123097487 14:105773385-105773407 AAGCAGGGCTGGTGGGAAGCAGG - Intergenic
1123097541 14:105773617-105773639 GAGCATGGCTGGTGGGAGGTGGG - Intergenic
1125517804 15:40332506-40332528 CAGAAGGGCTGTGGGGAAGTAGG - Intronic
1125756643 15:42069714-42069736 CAGAGGGCCTGCAGGGATGTGGG + Intronic
1126453982 15:48841482-48841504 CAGAAGGGCTGGTCAGCTGCAGG - Intronic
1127291310 15:57573849-57573871 CAGAAATGCTGATGGGATGTGGG + Intergenic
1127661386 15:61103170-61103192 GAGAAGGCATGGTGAGATGTGGG + Intronic
1128000645 15:64188316-64188338 CAGCTTGGCTGGTGGAATGTTGG - Intronic
1128052148 15:64674114-64674136 CAGAAGTGCTGCTGGCAGGTGGG - Exonic
1128666349 15:69540818-69540840 CAGCGGGGCTGGGAGGATGTGGG + Intergenic
1129244319 15:74270443-74270465 CAGAGGGGCTTGTGGGGTGTCGG + Intronic
1130258772 15:82338326-82338348 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130269912 15:82440777-82440799 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130462248 15:84168078-84168100 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130473868 15:84247000-84247022 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130481282 15:84361064-84361086 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1130490426 15:84426695-84426717 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130502016 15:84505465-84505487 CAGAAGGGCGGGAGGGATGGCGG - Intergenic
1130596151 15:85251615-85251637 CAGAAGGGCGGGAGGGATGGCGG + Intergenic
1131163960 15:90128864-90128886 AAGAAGGGCTTTTGGGATTTGGG + Intergenic
1131848100 15:96509493-96509515 AAGATGGGCTGGTGGCAGGTTGG + Intergenic
1132392611 15:101450138-101450160 CACTAGGGCTGGTGCGATGAGGG - Intronic
1132826734 16:1909014-1909036 CAAAAGAGGTGGTGGGATGATGG + Intergenic
1133018078 16:2954100-2954122 CAGAGGGGCTGGCAGGATGGGGG - Intergenic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1136475437 16:30510287-30510309 CAGGAGGGCTGGTGGCCTCTGGG + Intronic
1136610199 16:31361527-31361549 GTGAGTGGCTGGTGGGATGTGGG - Intronic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1137530516 16:49276166-49276188 CAGAGGGCCTGGGGAGATGTGGG - Intergenic
1137627595 16:49919473-49919495 CAGAGGAGCTGGTGGGAGTTGGG + Intergenic
1139747566 16:69087036-69087058 CAGAAGGGGCGGTGGGAGGTGGG - Intergenic
1139916818 16:70433506-70433528 GGGAAGGGCTGGTGGCATGTTGG - Intronic
1139962028 16:70723690-70723712 CAGCAGGGCTGGTAGGGTGATGG - Intronic
1140333918 16:74085400-74085422 GAGAGGAGCTGGTGAGATGTTGG - Intergenic
1140959394 16:79897604-79897626 CAGCAGGGCTGGTGGAATCAAGG - Intergenic
1142073765 16:88105730-88105752 CAGAAGCCCTGGTGGGAGCTCGG + Intronic
1142138437 16:88461982-88462004 CAGTAGGGCTGGTGGCCTGGGGG - Intronic
1142253300 16:89002496-89002518 CAGAAGAGCTGGGGGGACGGAGG + Intergenic
1142292776 16:89200525-89200547 GAGGAGGGCAGGTGGGAGGTGGG + Intronic
1143115527 17:4579947-4579969 CAGAATGTCTGCTGGGATGGAGG + Intergenic
1143164991 17:4893165-4893187 GAGAAGGGCTGTGGGGATGGAGG + Intronic
1144079226 17:11747488-11747510 CAGAAGAGCAGTTGGGATGCAGG + Intronic
1144327196 17:14193702-14193724 CAGGAGGGCTGGTGGTGTGCAGG - Intronic
1144476084 17:15590565-15590587 CAGGAGGGCTGGTGGTGTGCAGG - Intronic
1145017706 17:19410034-19410056 CAGAAGGGTTGGGGTGAGGTGGG - Intergenic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146594571 17:34157387-34157409 GAGAAGGGCTGGTGGGGGCTGGG + Intronic
1146948986 17:36892758-36892780 TAGGAGGGCTGGTGGGATGAGGG - Intergenic
1146974544 17:37099514-37099536 CAGGAGGGCTGATGGGAGGAGGG + Intronic
1147592820 17:41695895-41695917 CAGGAGGGCTGGGGGGGTTTGGG - Intergenic
1147636541 17:41967551-41967573 CAGAAGGGCTGGTGGGGGGCAGG - Intronic
1148219151 17:45849963-45849985 CAGAAGAGCTTGGAGGATGTAGG - Intergenic
1148289670 17:46433419-46433441 CATCAGGGGTGTTGGGATGTAGG + Intergenic
1148291486 17:46455003-46455025 CAGAAGGGCTGGTGCTTTGTAGG + Intergenic
1148311838 17:46650991-46651013 CATCAGGGGTGTTGGGATGTAGG + Intronic
1148313674 17:46672705-46672727 CAGAAGGGCTGGTGCTTTGTAGG + Intronic
1148482626 17:47970119-47970141 CAGATAGGCTGCTGGGATGATGG - Intronic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148741020 17:49892657-49892679 CAGAAGGCTTGGTGGGATGTGGG + Intergenic
1149621175 17:58046449-58046471 CAGAAGGCCTTGTGTGCTGTTGG - Intergenic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150055088 17:62007146-62007168 CAGAAGGGCTGCTTGGACCTGGG + Intronic
1151890572 17:76948571-76948593 CAGAAGGGCTGGGGCGGGGTAGG - Intronic
1154367236 18:13722299-13722321 CAGCAGGGATGGTTGGATCTAGG - Intronic
1154388929 18:13919889-13919911 CAGAAAGTCTGGTGGGTTTTAGG + Intergenic
1155042604 18:22077498-22077520 CAGAAGGGCTGGTGGCCTATTGG - Intergenic
1155096221 18:22559216-22559238 GAGGAGGGCTGGTGGGAGGATGG + Intergenic
1155430780 18:25754867-25754889 CAGAAGGGAAGGGGAGATGTTGG + Intergenic
1157396550 18:47346265-47346287 CAGCAGGGATGGAGGGCTGTTGG + Intergenic
1157998600 18:52589170-52589192 CAGAAGGGCTATTAGGATCTGGG + Intronic
1158824751 18:61204489-61204511 CAGATGGGTAGGTGGGATGTGGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1160269531 18:77371910-77371932 CTGATGGGCTGGTCGGATGGTGG + Intergenic
1160294729 18:77627576-77627598 CACAGGGGCTGGTGGGATCCAGG + Intergenic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1160899973 19:1422888-1422910 CAGCAGGGCAGGTGGGAGGAGGG + Intronic
1162824423 19:13243027-13243049 CAGAAGGGCAGGTGGGGTGGAGG - Intronic
1162955063 19:14092844-14092866 CTGAGGGGCTGGGGGGCTGTGGG + Exonic
1163273610 19:16268897-16268919 CAGACGGGCTGGTGGGTGGGCGG - Intergenic
1163430192 19:17262761-17262783 CAGAATGGCTGGGGGGCTGGTGG + Exonic
1165403914 19:35618566-35618588 CAGGAGGGCTGGCGGACTGTGGG + Exonic
1166529691 19:43534998-43535020 CAGGAGGGCTGGTGGGCTCCAGG - Intronic
1167211594 19:48137136-48137158 CAGCACGGCTGGTGGGGTGGAGG - Intronic
925072689 2:983589-983611 GAGAAGGGCAGGTGGGCTGGAGG - Intronic
926117261 2:10221356-10221378 AAGAAGGGTTGGGGGGATGGGGG + Intergenic
926166471 2:10524379-10524401 CTTAAGGGCTGCTGCGATGTAGG + Intergenic
926295287 2:11564609-11564631 CTGAAGAGCTGGAGGGATGTAGG - Intronic
927356290 2:22177427-22177449 GAGAAGGGCAGGTGGAATGAGGG + Intergenic
927672247 2:25078578-25078600 CAGCAGGGCTGGAGGGAAGCTGG - Intronic
928224696 2:29438645-29438667 CTGAAGGTCAGGTGGGATCTGGG - Intronic
928695227 2:33842302-33842324 CAGGAGCGCTGGTGAGGTGTTGG - Intergenic
930079587 2:47434812-47434834 AAGAAGTGCGGGTGGGATGATGG - Intronic
930378986 2:50603346-50603368 CAGAAAGGCTGTGGGGACGTGGG + Intronic
930511850 2:52355866-52355888 CAGAATGGAAGGTGGGATGGGGG + Intergenic
931251052 2:60530817-60530839 CAGGAGGGGTAGTGGGAGGTGGG - Intronic
931716481 2:65032915-65032937 CAGAAAGGTTGGGGGGATGGGGG + Intergenic
932688790 2:73895041-73895063 AAGAAGGGCTGGTGATAGGTTGG + Intronic
934771044 2:96907760-96907782 CACGTGGGCTGCTGGGATGTCGG + Intronic
934857673 2:97739239-97739261 CAGCAGGGCTGTTGGGGTGGCGG - Intronic
935224171 2:101038681-101038703 CAGAAGGGCGGGAGGAAGGTAGG + Intronic
936081494 2:109435481-109435503 CTGAAGTGCTGGTGGGCTCTCGG + Intronic
937203262 2:120219472-120219494 AAGATGGGCTGGGGGGTTGTGGG + Intergenic
937341712 2:121095579-121095601 CAGCAGGGACAGTGGGATGTGGG + Intergenic
937430706 2:121835784-121835806 AAGTATGGCTGGTGGGGTGTTGG + Intergenic
937790238 2:125952566-125952588 GAGAATGGGAGGTGGGATGTAGG + Intergenic
937929705 2:127194542-127194564 CAGAAAAGCCGGAGGGATGTGGG - Intronic
937934586 2:127232568-127232590 CAGGAGTCCTGGTGGGAGGTGGG + Intergenic
938240303 2:129738106-129738128 CAGATGGGCTCGTGGGTCGTGGG - Intergenic
940774847 2:157875571-157875593 CTGAACTGCTGGTGGGATATGGG - Intronic
941490460 2:166137158-166137180 GTGAAGGGCTGGTGGGAACTGGG + Intergenic
944930626 2:204515451-204515473 AATAAGGGCTTGTGGGATGGGGG - Intergenic
946118467 2:217486222-217486244 CAGAAGGGCAGGGGAGTTGTGGG + Intronic
946194788 2:218026654-218026676 GAAAAGGGCTGGAGGGAGGTAGG - Intergenic
946354100 2:219174104-219174126 AAGAAGGGCTCGAGGGATTTGGG - Intronic
948045446 2:234940237-234940259 TAGGAGGGCTGGTGGGAGGGCGG + Intergenic
948454604 2:238098995-238099017 CAGGAGGGGTGGTGGGCGGTGGG - Exonic
1168858227 20:1025321-1025343 CAGTAGGGCTGCTGGGGTGCTGG - Intergenic
1169305390 20:4485230-4485252 AAGAATGGGTGGTGGGAGGTGGG + Intergenic
1170869599 20:20193036-20193058 CAGAAGAGCATGAGGGATGTGGG + Intronic
1170981792 20:21221022-21221044 CAGCTGGGCTGCTGGGAGGTCGG + Intronic
1171204300 20:23267040-23267062 AGGAAGGGCCGGTGGGATGTAGG + Intergenic
1171205214 20:23273803-23273825 CAGAGGGTCTGGTGGGATGGAGG + Intergenic
1171387835 20:24782089-24782111 AAGAAGGTGTGCTGGGATGTGGG - Intergenic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1172517447 20:35544776-35544798 CAGAAGGGCTGGTGCCACGCGGG + Intronic
1172619038 20:36307432-36307454 GAGAAGGGCCGGAGGGATGGAGG - Intronic
1172799825 20:37567953-37567975 CAGAATGGCTGGTGGGGGGGGGG + Intergenic
1173441986 20:43085916-43085938 CAGAAGGGCTTGTAGGAGTTTGG + Intronic
1174538460 20:51271018-51271040 CAGAAGGGCAGAGGCGATGTTGG - Intergenic
1175155408 20:56967971-56967993 CAGAAGGGCCTGCGGGATGGAGG - Intergenic
1175258912 20:57662904-57662926 CTGCAGGGCCGGTGGGATGCAGG + Intronic
1175300392 20:57938753-57938775 CAAAAGGGATAGTGAGATGTAGG - Intergenic
1175696424 20:61106202-61106224 CAGAAAGGCTGGAGAGAGGTGGG + Intergenic
1176086062 20:63296058-63296080 CAGAAGGGCGGGTGAGATGCGGG + Intronic
1176510852 21:7746443-7746465 CAGAAGGGCTGTGGTGAGGTGGG - Intronic
1177078142 21:16604306-16604328 CAGAAGGTGTGTTGAGATGTGGG - Intergenic
1178644965 21:34376972-34376994 CAGAAGGGCTGTGGTGAGGTGGG - Intronic
1179519293 21:41931861-41931883 GAGGTGGGGTGGTGGGATGTTGG - Intronic
1180596105 22:16974533-16974555 CACAGAGGCTGGTGGCATGTGGG + Intronic
1181030843 22:20148298-20148320 CTGGAGGGCAGGTAGGATGTGGG + Intergenic
1181512482 22:23395089-23395111 CTGGAGGGCAGGTGGGATGTGGG - Intergenic
1181595747 22:23913520-23913542 CAGAAAGGTGGGTGGGAAGTGGG - Intergenic
1182395991 22:30036349-30036371 AGGAAGGGTTGGTGGGGTGTCGG - Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183101560 22:35587420-35587442 CAGGACTGCTGGTGGGATGTTGG - Intergenic
1183342030 22:37286799-37286821 CAGCAGGACTGGTGAGATTTGGG + Intronic
1183368377 22:37418997-37419019 CATCTGGGCTGGTGGGGTGTGGG - Intronic
1183465228 22:37976905-37976927 CAGAATGGCTGGTGGGATTTGGG + Intronic
1183936965 22:41268094-41268116 TACCAGGGCTGGTGGGATCTCGG + Exonic
1184298867 22:43543335-43543357 GAGAAGGGCTGGGGGCAGGTGGG - Intronic
1184648009 22:45906571-45906593 CTGATGGGCTGGTGGGCTGGTGG + Intergenic
1185107567 22:48882965-48882987 CAGAAGGGATGGATGGATGAGGG - Intergenic
950277011 3:11670451-11670473 CAAAAGGGCTGTTGGGACGCAGG - Intronic
950668153 3:14509594-14509616 CAGGAGGTCTGCTGGGGTGTGGG + Intronic
954211581 3:49100533-49100555 TAGAAGGGCTGGTGGTTAGTGGG - Intronic
954361825 3:50126237-50126259 CAGAAGGGATGGTGGGAAGAGGG + Intergenic
954384789 3:50238364-50238386 GAGCAGGCCTGGTGGGATGGGGG - Intronic
955060477 3:55488323-55488345 CAGAAGGGCTGGGGGGTGGGAGG - Intronic
955142657 3:56285106-56285128 CAGATGTGCTGGGGGGAGGTAGG - Intronic
955540186 3:59967626-59967648 CAGAAGGGTTGGTGGAAGCTTGG + Intronic
956679651 3:71766483-71766505 CAGAAGGGGTGGAGGTAGGTGGG + Intergenic
956826326 3:73000239-73000261 CAGAAGGATTGTTGGAATGTGGG + Intronic
956908874 3:73796114-73796136 CAGCAGGGATGGTGGGGTTTGGG + Intergenic
958807992 3:98834930-98834952 CAGAAGGGCTGGTGGCCTATTGG - Intronic
959125841 3:102289962-102289984 CAGAAGAGCTAGTGGGCTCTGGG + Intronic
959980147 3:112507059-112507081 CACAGGGGCAGGTGGGAAGTGGG - Intergenic
961262336 3:125612114-125612136 CAGCAGTGGTGGTGGGGTGTGGG + Intergenic
961371157 3:126432894-126432916 CAGAAATGCTGGTAGAATGTAGG - Intronic
962134368 3:132718701-132718723 CAGATGTGCTGGTGGGAGCTGGG + Intronic
962215365 3:133516330-133516352 CAGAATGGATGGTGAGAGGTGGG - Intergenic
963047050 3:141110185-141110207 GAGAAGAGGTGGTGGGAGGTTGG - Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
965415433 3:168387069-168387091 AAGAAGAGGTGGTGGGAAGTGGG - Intergenic
965541904 3:169879640-169879662 CACAAGGGCTACTGGGATATAGG - Intergenic
967263629 3:187670456-187670478 TAAAAGGGCTGGTGAGATCTGGG - Intergenic
968435120 4:581106-581128 CAGAAGCTCTGGTGGGAGGGAGG - Intergenic
968698390 4:2043427-2043449 CACTAGGGCTGGTGGGGGGTGGG - Intronic
968715633 4:2157123-2157145 AGGAAGGGCTGTTGGGCTGTGGG + Intronic
969459887 4:7323525-7323547 CAGGAGGGCTGGGAGGATGTGGG + Intronic
969549710 4:7856645-7856667 CTGAAGGCCAGGTGGGACGTAGG - Intronic
970246213 4:14066523-14066545 GAGAAGGGCTGCTGAGGTGTGGG + Intergenic
971272698 4:25165628-25165650 CAAAATGGCTGGTGGGAGGAGGG - Intronic
971340925 4:25768076-25768098 CTGAAGGGCATGTCGGATGTTGG + Intronic
971363630 4:25958933-25958955 CTGAGGGGCTGATGGGGTGTAGG + Intergenic
972251791 4:37309587-37309609 GAGAATGGCTGGGGGGAGGTGGG + Intronic
972511022 4:39769351-39769373 AAGAAGGGCTGTTGGGAGGGAGG - Intronic
976721307 4:88171313-88171335 TAGAATGGATGGGGGGATGTGGG + Intronic
979290191 4:118971404-118971426 CTAAAAGGATGGTGGGATGTAGG - Intronic
980563878 4:134512062-134512084 CAGAAGGGCTTGATGGGTGTAGG - Intergenic
981248698 4:142572421-142572443 CTGAAGAGTTGGTGGGAAGTTGG + Intronic
981842295 4:149126612-149126634 CAGAAGGGAGGGAGGGATGAAGG + Intergenic
982169674 4:152648807-152648829 CTCAAGGGGTGGGGGGATGTTGG - Intronic
982411924 4:155087168-155087190 CCTAAGTGCTGGTGGGATATGGG + Intergenic
982670417 4:158313945-158313967 CAGAAGGGCTGGTGGGCAGGTGG + Intergenic
983167440 4:164495763-164495785 CAGAAGTTTTGATGGGATGTGGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985042842 4:185909375-185909397 CAGAAGGGCTAGGGGTATGTGGG + Intronic
986871306 5:12049860-12049882 GAGAAGGACTGGTGGGGGGTTGG + Intergenic
987612766 5:20228606-20228628 GAGAGGGGTTGGTGAGATGTTGG - Intronic
987681502 5:21142899-21142921 CTGGAGGGTGGGTGGGATGTTGG + Intergenic
989669519 5:43899090-43899112 CACATAGGCTGGTGTGATGTGGG + Intergenic
992868282 5:80980262-80980284 GAGAAGGGCTGGTGGGCCCTGGG - Intronic
993834594 5:92802266-92802288 CTGAAGGGCTGGTGCAAGGTTGG + Intergenic
994153228 5:96473812-96473834 CAGAAGGGAAGAGGGGATGTAGG + Intergenic
994464104 5:100105562-100105584 CATATTGGCTGGTTGGATGTGGG - Intergenic
994467475 5:100156343-100156365 CAGAAGGGAAGGTGGAATGTGGG + Intergenic
995296505 5:110530723-110530745 GTGAAGGGCTGGGGAGATGTTGG + Intronic
996288061 5:121818356-121818378 CAGGTGGGCTGAGGGGATGTGGG + Intergenic
997397431 5:133574932-133574954 CAGAATGGTTTGTGGGATGCTGG + Intronic
998106730 5:139473560-139473582 CAGAAGGGATGGGGGAATTTGGG + Intergenic
999289079 5:150411770-150411792 CAGGAGGGATTGTGAGATGTTGG - Intronic
999585549 5:153085827-153085849 CTGAAGGGCTGGGGTGATATGGG + Intergenic
1000339957 5:160269354-160269376 CAGAAGCACTTGTGGGATGCAGG - Intronic
1001581624 5:172802393-172802415 CAGAGGGACTGATGGGATGGGGG + Intergenic
1001686803 5:173599456-173599478 CAGAAGGGGTGGCGGGGTGGCGG + Intergenic
1002281995 5:178136420-178136442 CAGAGGGGATGGTGGGGGGTGGG + Intronic
1003170510 6:3718472-3718494 CAGTAAGGGTGGTTGGATGTGGG - Intergenic
1003806705 6:9733447-9733469 CTGAAGGACTGGTAGGATTTGGG + Intronic
1003860741 6:10319629-10319651 CCGTAGGGATGGTGGGACGTGGG + Intergenic
1006136462 6:31899201-31899223 AAGAAGGGCTGTTGGGAGGGAGG - Intronic
1006557779 6:34883431-34883453 CAGAAGAGCTGGCTGGATGGAGG - Intronic
1006939792 6:37744113-37744135 CATCAGGGCTGGTGGGAGGATGG + Intergenic
1006945106 6:37779550-37779572 CAGAAGGGCTGGTGACCTGAGGG + Intergenic
1007394607 6:41570399-41570421 GAGAAGGACAGGTGGGAGGTGGG + Intronic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008176629 6:48275966-48275988 CAGAAAGGCAAGAGGGATGTGGG + Intergenic
1009450244 6:63791598-63791620 AAGAAGAACTGCTGGGATGTGGG + Intronic
1010659565 6:78554458-78554480 CAAAATGGCTGGAGGGATGGGGG + Intergenic
1010660253 6:78562220-78562242 CAGAAGGGAGGGTGGGGAGTTGG + Intergenic
1011184894 6:84663185-84663207 GAGAAGGGAGGGTGGGATGAGGG + Intergenic
1011525957 6:88265238-88265260 CAGCATGACTGGTGGGATGAAGG + Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1015505603 6:133983539-133983561 CTGAACGGCTGGTGGGGAGTGGG + Intronic
1018197604 6:161368711-161368733 CAGAAGGGCGGGTGGGCAGCTGG - Intronic
1018953535 6:168393538-168393560 CAGAAGGGATGGGTGGAAGTGGG + Intergenic
1019062053 6:169263615-169263637 CAGAAGGGCAGCTGGGAGGGAGG - Intergenic
1019974455 7:4569483-4569505 AAGGAGTGCTGGAGGGATGTGGG - Intergenic
1021948518 7:25752223-25752245 CTGCAGGGCTGGGGGGAAGTAGG + Intergenic
1033131782 7:138751252-138751274 CAGCAGGGCCGGTGGGAGGCAGG - Intronic
1033413813 7:141145140-141145162 CACCAGGCCTGGTAGGATGTAGG - Intronic
1033608797 7:142946163-142946185 AGGAAGGGGTGGAGGGATGTGGG + Intronic
1033813348 7:145043847-145043869 CAGATGGGATGGTGGGATCTAGG + Intergenic
1033865112 7:145681108-145681130 AAGAAAGGCTTCTGGGATGTTGG - Intergenic
1033926553 7:146469218-146469240 GAGAAGGGTTGCTGTGATGTGGG - Intronic
1035662666 8:1359535-1359557 CCGAAGGCCTGGAGGGATTTGGG + Intergenic
1036699828 8:11005394-11005416 TGGAAGGGCTGGAGGGAAGTGGG + Intronic
1037430861 8:18811790-18811812 CAAATGGGCTTGTGGGATGGAGG + Intronic
1038315947 8:26484521-26484543 CATAAGTGGTGGTGGAATGTGGG - Intronic
1038347840 8:26748344-26748366 CAGCAGGGCTGGACGGATGTTGG - Exonic
1038871608 8:31500903-31500925 CAGGAAGGATAGTGGGATGTTGG - Intergenic
1039428781 8:37509320-37509342 CAGAAGGTCTGTTGGGATGATGG - Intergenic
1040820226 8:51547545-51547567 CAGTAGGGCTACTGGGCTGTAGG - Intronic
1042064023 8:64853970-64853992 CACAAGGGCAGGTGGGAGGTAGG + Intergenic
1042669600 8:71246966-71246988 GAGAAGTTCTGGAGGGATGTGGG - Intronic
1044510750 8:93075709-93075731 CTGAAGGGCAGGTGAAATGTGGG + Intergenic
1046614682 8:116463266-116463288 CAAGAGGGCTGATGGGCTGTGGG - Intergenic
1047585912 8:126272287-126272309 CAGAAGGCTTGGTGGGGTGGTGG - Intergenic
1049375839 8:142288664-142288686 CAGAGGAGCTGGTGGGGGGTGGG + Intronic
1049576008 8:143389921-143389943 CAGAGGGCCTGGTGTGCTGTTGG + Intergenic
1049782490 8:144435313-144435335 CAGAGGGGCTGGTGGTGTGCTGG - Intronic
1050642839 9:7686728-7686750 CAGGAGGTTTAGTGGGATGTAGG + Intergenic
1051361500 9:16285449-16285471 CAGGAGGGCTGATGGGATGAGGG - Intergenic
1052056288 9:23911168-23911190 CAGAGCTGCTGGTGGGAGGTGGG - Intergenic
1052126462 9:24781238-24781260 CAGAAAGGCAGTTGGGATATGGG + Intergenic
1052848032 9:33354591-33354613 CTGAAGGACAGGTGGGATGATGG - Intronic
1053280831 9:36819049-36819071 CAGAAAGGCTGGTGGGGGGGAGG - Intergenic
1053472448 9:38356671-38356693 CAGAAAGGCAGCTGGGATGCAGG - Intergenic
1054957758 9:70932933-70932955 CAGAAGAGATGGTGAGAAGTAGG + Intronic
1056318392 9:85413987-85414009 GAGAAGGGCAGGTAGGGTGTTGG + Intergenic
1056691693 9:88813461-88813483 CAGGAGGCCTGATGGGATGTGGG - Intergenic
1057210168 9:93196787-93196809 CAGGAGGGGTGGCGGGCTGTGGG + Intronic
1059114120 9:111585576-111585598 CTGAAGGGTTGGGGAGATGTTGG - Intronic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1060267804 9:122122365-122122387 CAGAGGGGCTGGTGTGCTGGTGG - Intergenic
1060822335 9:126668823-126668845 CAGGAGGGCCTGGGGGATGTGGG - Intronic
1061675646 9:132214190-132214212 CAGGAGGGCGGGTGGAATGTAGG - Intronic
1062057219 9:134474933-134474955 CAGAGGGGCTCCTGGGGTGTGGG - Intergenic
1062173000 9:135145679-135145701 CAGAAGGGCGGGTGCACTGTTGG - Intergenic
1062703159 9:137918635-137918657 CATGAGGGCTGGTGGCATGATGG + Intronic
1203776842 EBV:78020-78042 CAGTAGGGCCGGTGGCATTTGGG + Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1185950452 X:4426712-4426734 CAGATGGGATGGGTGGATGTAGG + Intergenic
1186927468 X:14350905-14350927 CGGAGGGGCTGGTGGGAAGGTGG + Intergenic
1187032769 X:15504882-15504904 TAGAAGAGCTAGTGGGATCTGGG - Intronic
1187152563 X:16694449-16694471 GACAAGGGCTAGTGGGATATAGG - Intronic
1187464997 X:19519207-19519229 CAGTGGGGCTGGGGGGAGGTAGG - Intergenic
1187768840 X:22672543-22672565 AAGAAGGGCTGAAGGGAGGTTGG + Intergenic
1189924637 X:45939691-45939713 TGAAAGGGATGGTGGGATGTGGG + Intergenic
1190245384 X:48687338-48687360 GAGAAGGGCTGGTGGGTAGGTGG + Intronic
1192678506 X:73226091-73226113 CAGAATGGCAGGTGGGAAGATGG - Intergenic
1194801628 X:98280684-98280706 AAGAGGGGCAGGTGGCATGTGGG - Intergenic
1195081087 X:101371562-101371584 TAGAAGGGGTGGTGGGGTGCAGG - Intronic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1197942462 X:131803692-131803714 CTGAAGGGCCGGGGGGATGGAGG - Intergenic
1198257035 X:134932864-134932886 GGGGAGGGCTGGTGGGATGATGG - Intergenic
1200097906 X:153672704-153672726 CAGACGGGGCGGTGGGAGGTGGG + Intronic
1200116906 X:153773443-153773465 CAGGAGGGAAGGTGGGATGCGGG + Intronic
1202367802 Y:24178858-24178880 CAGAAGGGTGGGAGGGATGGCGG + Intergenic
1202502981 Y:25491265-25491287 CAGAAGGGTGGGAGGGATGGCGG - Intergenic