ID: 1104846294

View in Genome Browser
Species Human (GRCh38)
Location 12:131848757-131848779
Sequence CCTTCCTGGCTGAGGCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 396}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104846287_1104846294 16 Left 1104846287 12:131848718-131848740 CCTCGGGGCTCATACACGCGGTG 0: 2
1: 0
2: 0
3: 4
4: 27
Right 1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG 0: 1
1: 0
2: 2
3: 38
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104846294 Original CRISPR CCTTCCTGGCTGAGGCTGAG CGG Intronic
900759877 1:4463420-4463442 CCTTCCTAGCTGGGGCTGGTGGG + Intergenic
901205420 1:7492183-7492205 CCTTCCTCGCAGAGGATGATGGG - Intronic
901325340 1:8361924-8361946 ATTTCCTTGCTGAGGCTGATGGG - Intronic
901460205 1:9386678-9386700 TCTTCCTGGCTGTTGTTGAGCGG - Intergenic
901815157 1:11789616-11789638 CCTCACTGGCTGGGGCAGAGGGG - Exonic
902453590 1:16515427-16515449 CCAAGCTGGCTAAGGCTGAGTGG + Intergenic
902473645 1:16668091-16668113 CCAAGCTGGCTAAGGCTGAGTGG + Intergenic
902485158 1:16739351-16739373 CCAAGCTGGCTAAGGCTGAGTGG - Intergenic
902498892 1:16894835-16894857 CCAAGCTGGCTAAGGCTGAGTGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902999101 1:20252014-20252036 CATTCCTGGCAGAGGCAGTGTGG - Intergenic
903372265 1:22844339-22844361 TCTTCCTGGCTGAGGCTTTTGGG - Intronic
903910827 1:26723605-26723627 CCTTCCTGGCAGGGGCGGTGTGG + Intronic
904213261 1:28899551-28899573 CCATCCAGGCTTAGGCTGGGGGG + Intronic
905772892 1:40649783-40649805 CCTGCCTTGCCCAGGCTGAGTGG - Intronic
907983929 1:59511831-59511853 GCTTCCTGGCAGAGGATAAGAGG - Intronic
908651060 1:66333708-66333730 GCTTGCTGGCTGCGGCTCAGAGG + Intronic
910010464 1:82454788-82454810 CATTTCTGGTTAAGGCTGAGAGG + Intergenic
910208374 1:84770310-84770332 CCCTCCTGCCAGAGGCTGAAGGG + Intergenic
910984428 1:92991859-92991881 CAGTCCTGGCTGAGGCTCTGTGG + Intergenic
912549741 1:110477615-110477637 CCTTCCTCCCTAAGGTTGAGAGG + Intergenic
913146012 1:115990718-115990740 CCATTCTGGGTAAGGCTGAGAGG - Intronic
913190001 1:116405495-116405517 CACTCATGGCTGAGACTGAGGGG - Intronic
915216006 1:154341158-154341180 CCTTCCTAGTTGGGTCTGAGGGG + Intronic
916213333 1:162375532-162375554 TCTGCCTGGCTGAGTTTGAGAGG - Intronic
916485324 1:165253721-165253743 ACTTCCTTTCTGAAGCTGAGAGG - Intronic
916666552 1:166973003-166973025 TCTACTTTGCTGAGGCTGAGAGG + Intronic
917947726 1:179993541-179993563 GCTTCCTAGCTGAGGCTTACAGG + Intronic
917967316 1:180186863-180186885 CCTTCCTCTCTGAAGGTGAGAGG + Intronic
918366792 1:183816471-183816493 CATTCCTGGCTGAGGCAGTGGGG - Intronic
918470536 1:184868296-184868318 CCATACTGGCTGTTGCTGAGGGG - Intronic
919727466 1:200893629-200893651 CTGCCCAGGCTGAGGCTGAGGGG - Intronic
921620971 1:217325865-217325887 CCTTCTGGGCTAAGGCTGACTGG - Intergenic
922211599 1:223490693-223490715 CTCTCCTGGCAGGGGCTGAGCGG - Intergenic
922533002 1:226358623-226358645 CCTTCCATGCTGAGGCTGAATGG + Intergenic
922725842 1:227922665-227922687 CCCTCCCTGCTGAGGGTGAGGGG - Intronic
923335774 1:232968911-232968933 CCTTCCTGGGGAAGGCTGACAGG - Intronic
923663798 1:235981068-235981090 CCTTCAAGGAGGAGGCTGAGTGG + Intronic
1063451654 10:6154189-6154211 CCTTCCTGTCTCCAGCTGAGAGG - Intronic
1064425098 10:15223354-15223376 CTTTCCTGGCTGATGCAGAGAGG - Intronic
1065546402 10:26825968-26825990 CCCTCATGGATGATGCTGAGGGG - Intronic
1065937620 10:30534811-30534833 TCTGCGTGGCTGTGGCTGAGGGG - Intergenic
1067156167 10:43782980-43783002 CCTTGCTGGCTGAGTCTGTGGGG - Intergenic
1067287050 10:44914399-44914421 CCTCCCTGGCTCAGGATGTGGGG + Intronic
1067551363 10:47238628-47238650 CCTTCCTGGGTGGTGCAGAGTGG - Intergenic
1067711809 10:48656219-48656241 CCGTCCTGCCTGAGGATGCGGGG - Intronic
1069557241 10:69406468-69406490 CCTTCCTGGCTGTCTCTGACAGG + Intronic
1070604087 10:77886305-77886327 CATTTCTGGCTGAGGGTCAGTGG - Intronic
1072489881 10:95894604-95894626 CATTCCTTGTTGTGGCTGAGTGG - Intronic
1072537871 10:96377012-96377034 CCTTCCTGACTGTGGCTCGGGGG + Intronic
1072861808 10:99013996-99014018 CCTCCCTGGCTCAGGCTAAGGGG + Intronic
1073070213 10:100788489-100788511 CCATGTTGGCTGAGGCTGATGGG + Intronic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1073482665 10:103796723-103796745 CCAGCCTGGCTGAGTGTGAGAGG - Intronic
1074113105 10:110436612-110436634 TCTGCCAGGCTGGGGCTGAGAGG + Intergenic
1074298234 10:112210612-112210634 CTTTCCTGGGTGGGGTTGAGGGG - Intronic
1074523699 10:114246987-114247009 CATGCCTGGCCCAGGCTGAGGGG - Intronic
1074556621 10:114497277-114497299 CCGTCCTGCCTGAGCCTGAGTGG + Intronic
1074775838 10:116767518-116767540 CCTTGCTGGCTGAGGCTAGTGGG - Intergenic
1074902008 10:117825147-117825169 CCTTACTGTCCGCGGCTGAGAGG + Intergenic
1075413610 10:122247020-122247042 CCTTCGTGGCTGGAGCAGAGAGG + Intronic
1075648533 10:124112314-124112336 CCCCCCTGGATGGGGCTGAGAGG - Intergenic
1075784960 10:125042787-125042809 CCCTTCTGGCTGAGGCTGGGAGG + Intronic
1075863248 10:125695989-125696011 CCTCCCAGGCTGAGTGTGAGAGG + Intergenic
1076681055 10:132171379-132171401 CCTGCCGGGCTGTGGGTGAGGGG - Intronic
1076727890 10:132421829-132421851 CCTTCCTGGGTGTGGCTGGGGGG + Intergenic
1076850872 10:133092103-133092125 CATTCCTGGCAGAGGCCAAGGGG - Intronic
1077472660 11:2771281-2771303 CCTTCCTGGCTGATGGAGAAAGG - Intronic
1077506874 11:2933666-2933688 CCTTCCTGACTGAGGAGCAGTGG - Intergenic
1077998463 11:7474124-7474146 CCTTCCTGAAAGTGGCTGAGGGG + Intergenic
1079084281 11:17434020-17434042 CATTACTGGCTGAGGAGGAGAGG + Intronic
1084172441 11:67407002-67407024 CCTTCCTCAGTGAGGGTGAGTGG + Exonic
1084604832 11:70166411-70166433 CCATGCTGGCTGAGGATGGGGGG + Intronic
1084953425 11:72679013-72679035 GCTTCCTGGCAGAGGAGGAGTGG - Intergenic
1085283638 11:75346327-75346349 CCTTTCAGGCTCAGGCTGAGGGG - Intronic
1090064955 11:123494787-123494809 CCTTCTTCGCTGAGGCTGGTAGG - Intergenic
1090640483 11:128725431-128725453 CCTGGCTGCCTGAGGCTGACAGG - Intronic
1091037079 11:132244065-132244087 CATTCCAGGCTGGGGCTGACAGG + Intronic
1093743117 12:22710822-22710844 CCTTCCTGGCAGAGGCACAAAGG - Intergenic
1094101596 12:26770372-26770394 CATTTCTGGCTGAGGCACAGAGG - Intronic
1095991703 12:48039232-48039254 CCATTGTGGCTGAGGCAGAGTGG + Intergenic
1096670220 12:53194048-53194070 CCTTCCTGGAGCAGTCTGAGTGG - Exonic
1096716830 12:53496453-53496475 CCTCCATGGGTAAGGCTGAGGGG - Intronic
1097178749 12:57158800-57158822 CCTTCTTGGCTGAGCCAAAGAGG + Intronic
1098484341 12:71003501-71003523 CCTGCCTGGCTGATCCTGATTGG - Intergenic
1098521508 12:71439573-71439595 TCTTCCAGGCGGAGGCTCAGTGG + Intronic
1098779755 12:74671891-74671913 CCTTCATGGCTGACTTTGAGGGG + Intergenic
1101707277 12:107232269-107232291 CCAGCCTGGCTGAGGCCCAGAGG - Intergenic
1102536796 12:113587850-113587872 CCTTTCTCGCTGGGGCTCAGCGG - Intergenic
1102722404 12:115028676-115028698 CCTGCCTGGCTGAGGGTGTCAGG + Intergenic
1104277161 12:127340275-127340297 CCTTCCACACTGAGGGTGAGGGG - Intergenic
1104846294 12:131848757-131848779 CCTTCCTGGCTGAGGCTGAGCGG + Intronic
1105316335 13:19268109-19268131 GCTTTCTTGCTGAGGCTGTGGGG - Intergenic
1105483562 13:20803425-20803447 CCTGCCTGACTCAGGCTGAGTGG - Intronic
1105888971 13:24668491-24668513 CACTGCTTGCTGAGGCTGAGGGG + Intergenic
1108527299 13:51296756-51296778 CCTTCCTGGTTTGGGGTGAGAGG + Intergenic
1109123594 13:58489014-58489036 CCAGTGTGGCTGAGGCTGAGTGG + Intergenic
1109250138 13:60009678-60009700 ACTGCCAGGCTGAGGCCGAGTGG + Intronic
1110649867 13:77931430-77931452 CCTTACTGGCTGTAGCTGATCGG + Intergenic
1111041811 13:82758092-82758114 CCCTCCTTGCTCAGGCTTAGAGG - Intergenic
1112155227 13:96809856-96809878 CCTTCCTCCCTGAGGCTTATGGG + Intronic
1112319855 13:98396082-98396104 GCTACCTGGCTAAGGATGAGTGG - Intronic
1112328582 13:98460159-98460181 CATTCCAGGCTGCGGCGGAGTGG + Intronic
1113749820 13:112769294-112769316 CCCTCCTCTCTGAGGCTCAGAGG + Intronic
1113869632 13:113551234-113551256 CCTGTCTGCCTGAGGCTGACTGG + Intronic
1113914361 13:113861954-113861976 CCCTCCTGCATGTGGCTGAGTGG - Intronic
1114287895 14:21262593-21262615 CCTTCCTGGGTGATGGTAAGAGG - Intronic
1114690212 14:24574145-24574167 GCTGCCAGGCTGAGGCTGTGGGG + Intronic
1117982871 14:61359047-61359069 CCTTCAGGACTGAGGCTGGGAGG - Intronic
1118779136 14:68994650-68994672 GCTTGCTGGCTGAGGCTGGAAGG - Intergenic
1118808120 14:69255303-69255325 CCTTCCTGCCCCAGGATGAGGGG - Intergenic
1120149992 14:81022384-81022406 GTTTTCTGGCTGTGGCTGAGGGG + Intronic
1121315556 14:92959166-92959188 CCGTGCTGGCCGGGGCTGAGAGG - Intronic
1121719420 14:96098779-96098801 CCTTCCTGGCTGCTCCTGTGTGG - Intergenic
1121736581 14:96222171-96222193 TCCACCTGGCTGTGGCTGAGTGG - Intronic
1122130417 14:99601979-99602001 CCTCCCCAGCTCAGGCTGAGGGG + Intronic
1122718951 14:103711692-103711714 CCTTCCTGGGAGAGGCTGGGTGG - Exonic
1122858973 14:104573784-104573806 CCCACCTGGCAGTGGCTGAGTGG - Intronic
1122924879 14:104894924-104894946 CCTTCCTCCCTGATGCCGAGAGG + Exonic
1122935659 14:104954888-104954910 CCCTGCTGGCTGAGCCTGGGAGG - Intronic
1124182676 15:27491362-27491384 GCTGCCTGTCTGAGGCTGGGAGG - Intronic
1124425693 15:29560688-29560710 CCTCCCTAGATGAGGCTGTGGGG - Intronic
1125137457 15:36360179-36360201 CCTGCCTAGCCGAGGCAGAGTGG + Intergenic
1127808848 15:62545756-62545778 CCATCCTGGCTGAGGTGTAGTGG + Intronic
1128153206 15:65376520-65376542 CCTCCCTGGCTGAGGGAGATGGG + Intronic
1128187212 15:65652510-65652532 CCTTCCTCACTCAGGCTGAGGGG + Intronic
1128454439 15:67824706-67824728 GCTTTCTGGCTGAGGCAGGGAGG - Exonic
1129820765 15:78600360-78600382 CCATCCTGGCTTAGGCGCAGTGG - Intronic
1132313017 15:100870855-100870877 CCGCCCTGACTCAGGCTGAGTGG - Intergenic
1132550348 16:551434-551456 CCGGCCTGGCTGAGGGTGGGTGG + Intronic
1132613690 16:830029-830051 CCTTCCTTCTTGTGGCTGAGTGG + Intergenic
1132661200 16:1062280-1062302 CCGTCCTTGCTGTGGCTGACGGG + Intergenic
1132943803 16:2521134-2521156 GCTCCCTGGCTGAGGTGGAGGGG + Intronic
1133702258 16:8319771-8319793 TGTTTCTGGCTGAGGCTGACAGG - Intergenic
1134308737 16:13057128-13057150 CCTTCCTGCCTGGGGCTGGAGGG + Intronic
1134867436 16:17620741-17620763 CATTCCTGCCTGTGGCAGAGAGG - Intergenic
1135143264 16:19939799-19939821 CATTGCTGGCTGGGCCTGAGTGG - Intergenic
1135753757 16:25079186-25079208 CATTCTTGGCTGAGCTTGAGAGG + Intergenic
1136024356 16:27460454-27460476 ACCTGCTGGCTGAGGCTGGGCGG + Intronic
1136367741 16:29816639-29816661 CCTTACCGGCCGAGGCAGAGGGG - Exonic
1136376391 16:29867980-29868002 CCTTGCTGGCTGAGGCTGGAGGG - Intergenic
1136662107 16:31772049-31772071 CCCTCCTCACTGAGGGTGAGGGG + Intronic
1137592192 16:49700467-49700489 GCTTCCTGACTGGGGCGGAGGGG + Intronic
1139590180 16:67928989-67929011 CCTTCCAGCTTGAGGCTCAGTGG - Exonic
1139640415 16:68287637-68287659 CCTTCCTGCCTAAGGCAAAGGGG - Intronic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1140767989 16:78177704-78177726 CATCACTGGCTGAGTCTGAGTGG + Intronic
1140794510 16:78424630-78424652 CCTCCGTTGCTGAGGATGAGAGG - Intronic
1140872153 16:79116689-79116711 CCTTCTTGGGTGACTCTGAGGGG - Intronic
1141354979 16:83336985-83337007 CTTTCATGGCTGAAGATGAGAGG + Intronic
1141864254 16:86739274-86739296 CGTTCCTAGCTGAGGCTTGGTGG - Intergenic
1141996767 16:87640986-87641008 CCTTCCAGGCTGGGGTTGTGAGG - Intronic
1142083924 16:88165948-88165970 CCTTCCCTTTTGAGGCTGAGTGG + Intergenic
1142284742 16:89167174-89167196 CCAGCAAGGCTGAGGCTGAGTGG - Intergenic
1142416584 16:89946711-89946733 CCTGCCTGGCTGAGCCTCTGTGG - Intergenic
1142860066 17:2755861-2755883 CGTCCCGGGCTGAGGCTGCGGGG + Intergenic
1143136390 17:4714887-4714909 GCCTCCTGCCTGAGGCTGTGGGG - Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1144560347 17:16316015-16316037 ACTGCCTGGCAGAGCCTGAGAGG - Intronic
1146226187 17:31068408-31068430 CTTTCCTGGCTGAAGCTGAGTGG + Intergenic
1146552183 17:33790984-33791006 CAATTCTGGCTGAGGCTGACTGG - Intronic
1146937882 17:36823937-36823959 CCTCTCTGGCTGAGGCTGGCAGG - Intergenic
1147865444 17:43548979-43549001 CAGCCCTGGCAGAGGCTGAGTGG + Intronic
1147932982 17:43994651-43994673 CCTCCGTGGCTCAGCCTGAGGGG + Intronic
1148806655 17:50267240-50267262 TCTTCCAGGCTGGGGCTGAAAGG - Intergenic
1148853283 17:50565066-50565088 CCATCCTGGCTGAGGCAGGCAGG - Intronic
1149295449 17:55258111-55258133 CTTTCCTGACTCTGGCTGAGTGG + Intergenic
1149624394 17:58069846-58069868 CCTTCCTGCTAGAGGCTGAGTGG + Intergenic
1150286847 17:63959513-63959535 ACCTCCTGGCAGAGGCTGCGGGG + Intronic
1151155868 17:72122745-72122767 CCTTCGTGGAGGAGGCGGAGCGG + Exonic
1151534365 17:74730380-74730402 CCTTCCTGGCTGTGACCCAGTGG - Intronic
1151655723 17:75495087-75495109 TCTTCCTGGCTGTGGCTCTGAGG - Intronic
1151924967 17:77188531-77188553 CCTTCCTGAGTGAGGCTAAATGG - Intronic
1152129344 17:78466661-78466683 GCTTCCTGGAGGAGACTGAGGGG - Exonic
1152217601 17:79042793-79042815 CCTGACTGGCTGAGGCTCTGGGG + Intronic
1152329449 17:79663683-79663705 CCTTGTTGGCTGAGGGTCAGGGG - Intergenic
1152580194 17:81162396-81162418 GCTTGCTGCCTGAGCCTGAGTGG + Intronic
1152681836 17:81672481-81672503 CCTGCCAGGCTGAGGGAGAGAGG - Exonic
1153986117 18:10352355-10352377 CTTTCCAGGCTGAGCCTCAGGGG - Intergenic
1154358686 18:13641913-13641935 CGTTCCTGGCTACGGCTGACTGG + Intronic
1154358973 18:13643341-13643363 CCTTCCTGGCGGAGGGGAAGGGG - Exonic
1156460252 18:37317746-37317768 GATTGCTGGCTGAGGCTGACAGG - Intronic
1156651581 18:39232995-39233017 CCCTCCTGGGAGAGGTTGAGTGG - Intergenic
1157244627 18:46042271-46042293 CCTTCCTGGCTAAGACAGAGGGG - Intronic
1157364434 18:47050871-47050893 CATTCCTGGCAGAGGCACAGAGG + Intronic
1158346007 18:56517891-56517913 CCTGCGGGGCTGAGGTTGAGGGG - Intergenic
1160563959 18:79775518-79775540 CCGTCCTGGGTGGGGCAGAGCGG + Intergenic
1160803040 19:979388-979410 CCATCCTGGCCGAGGCTGGCCGG + Intergenic
1160902537 19:1435818-1435840 GCTTCAGGGCAGAGGCTGAGTGG + Intergenic
1161054960 19:2186237-2186259 CGTTCCTGCCTGAGGCTGCTGGG + Intronic
1161266399 19:3366649-3366671 CGTACCTGGGTGAGGCAGAGCGG - Exonic
1161515832 19:4695722-4695744 CCTTCCTGGCACATGCTTAGGGG + Intronic
1161708740 19:5835134-5835156 CCTTCAAAGCTGAGGCTCAGTGG - Intronic
1162152864 19:8657923-8657945 ACTTCAAGGCTGAGGCTGAGGGG + Intergenic
1162458932 19:10802980-10803002 CCTTCCTGCCTGAGGCAGGCCGG + Intronic
1163665999 19:18604337-18604359 CCTTACCGGCTGGGGCTAAGGGG - Intronic
1163819614 19:19488478-19488500 CCTTCCCGGCACTGGCTGAGGGG + Intronic
1166071393 19:40390121-40390143 CCCTCCTGGCTTGGGATGAGGGG + Exonic
1166105922 19:40598064-40598086 CCTTCCTGTCTGCGGGTGACGGG + Intronic
1166749061 19:45156113-45156135 CCCACCAGGCTGAGGCTGGGAGG + Intronic
1167033343 19:46978202-46978224 CCTTCCTGCCTGAGGCTTACAGG + Intronic
1167713560 19:51126329-51126351 TCTTCTTGTTTGAGGCTGAGGGG - Intronic
1168241429 19:55091060-55091082 CCCACCTGGCTGAGGCTGGCGGG + Exonic
1168476370 19:56678371-56678393 CTGTCCTGGCAGAGGATGAGAGG - Intergenic
1202705836 1_KI270713v1_random:23166-23188 CCAAGCTGGCTAAGGCTGAGTGG + Intergenic
925151669 2:1619310-1619332 CCCTCCTGTATGCGGCTGAGTGG - Intergenic
925151691 2:1619396-1619418 CCCTCCTGTATGCGGCTGAGCGG - Intergenic
925151703 2:1619439-1619461 CCCTCCTGTATGCGGCTGAGCGG - Intergenic
925151715 2:1619482-1619504 CCCTCCTGTATGCGGCTGAGCGG - Intergenic
925151727 2:1619525-1619547 CCCTCCTGTATGTGGCTGAGTGG - Intergenic
925151739 2:1619568-1619590 CCCTCCTGTATGTGGCTGAGTGG - Intergenic
925151751 2:1619611-1619633 CCCTCCTGTATGCGGCTGAGTGG - Intergenic
925477666 2:4235849-4235871 CCTTCCTGGTTGTTGGTGAGAGG - Intergenic
926385559 2:12332664-12332686 CCTTTCTTGCTGAGGTTGTGGGG + Intergenic
926987208 2:18638273-18638295 CCTTCCTGGGTGTGTCTGTGAGG + Intergenic
927051253 2:19331567-19331589 TCTTCCTGGCTAAGGCTCATGGG - Intergenic
927216197 2:20669044-20669066 CTTGGCTGGCTGAGCCTGAGAGG + Intronic
927811235 2:26181409-26181431 CCTGCCTGGCGGAATCTGAGAGG - Intronic
928241573 2:29591387-29591409 CCATCCTGGCTGTGGCTGCCCGG - Intronic
930075138 2:47400433-47400455 GATTCCAGGCTGAGGCTGGGCGG + Intergenic
930091629 2:47535216-47535238 CCTCCCTGGCTGCAGCTGAAAGG - Intronic
931239550 2:60439801-60439823 CTTTCCTGGCTTAGGCTGGGAGG - Intergenic
932311312 2:70744594-70744616 CCATTGTGGCTGAAGCTGAGTGG + Intronic
932342571 2:70975585-70975607 CCTCCCTGACTGAGGCAGAAAGG + Intronic
932423212 2:71613393-71613415 CCTACCTGGATGGGGATGAGGGG - Exonic
932776792 2:74533031-74533053 CCTTTCTGGCTGAGGTTCTGAGG + Exonic
933906730 2:86901401-86901423 CCTTCCTGCCTGTGCCTGTGTGG - Intergenic
935775820 2:106470310-106470332 CCTTCCTGCCTGTGCCTGTGTGG + Intergenic
935794552 2:106628700-106628722 CCTGCCTGTTTGAGGCTGACAGG - Intergenic
936365432 2:111850270-111850292 CCTTCCTGCCTGTGCCTGTGTGG + Intronic
937341744 2:121095707-121095729 CCTGCCTGACTAAGGGTGAGGGG + Intergenic
937763693 2:125634896-125634918 CCTGTCTGGCTGTGGGTGAGGGG - Intergenic
937907958 2:127061535-127061557 CTTTCCTGGCTGTGGATCAGAGG - Intronic
938680926 2:133689382-133689404 CCTGCCTGGCTGAGGGGAAGAGG - Intergenic
939166709 2:138648455-138648477 CCTTCTGAGCTTAGGCTGAGTGG - Intergenic
939612887 2:144332055-144332077 TCTTCCTCGCGCAGGCTGAGAGG - Intronic
939958527 2:148546460-148546482 ACTTCCTGCCTGAGGCTGGAAGG - Intergenic
940015243 2:149097567-149097589 CCTACCTGGCTGAGACTGTTAGG - Intronic
941401180 2:165032807-165032829 CCTGCCTCCCTGAGGCAGAGAGG - Intergenic
942427701 2:175877116-175877138 CCTTCCTTCCAGAGGCTGAAAGG - Intergenic
942911097 2:181245283-181245305 AGATCCTGGCTGAGGCTGAATGG - Intergenic
944708210 2:202312041-202312063 GCTTCCTGGCTCAGGTTAAGAGG - Intergenic
946397727 2:219451673-219451695 TCCTCCGGGCTGAGGGTGAGCGG + Exonic
947346932 2:229201457-229201479 CCTTCCTGTTTAAGGCTGAAGGG + Intronic
947389227 2:229622500-229622522 CCGTGCTGACTCAGGCTGAGGGG - Intronic
947771675 2:232675401-232675423 CCAGCCTCCCTGAGGCTGAGAGG + Intronic
948018823 2:234713274-234713296 CCTTCCTGGCTAAGAATGATGGG + Intergenic
948516625 2:238508052-238508074 TGCTCCTGGCTGGGGCTGAGTGG + Intergenic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1168953319 20:1817383-1817405 CCTGCCTGGCTGACCCAGAGCGG - Intergenic
1172949579 20:38714258-38714280 CCTTGCAGGCTGAGGGTGGGGGG + Intergenic
1173989484 20:47290218-47290240 CCTTCCTGGCTGATGCAAAGTGG - Exonic
1174139202 20:48400889-48400911 GCCTCCTGGCAGAGGCTCAGAGG - Intergenic
1174417338 20:50376335-50376357 CCTTGCTGGCTGCCCCTGAGTGG + Intergenic
1174532158 20:51222570-51222592 CCTCCCTGGCTGATGCTGTGAGG - Intergenic
1174986013 20:55452772-55452794 CCTTCCTGGCAGGGGTTGTGAGG - Intergenic
1175242636 20:57561035-57561057 CCTCCCTGGGTGCAGCTGAGGGG + Intergenic
1175569686 20:60009505-60009527 CCTGCCTGGCTGAGCAGGAGAGG + Intronic
1175635578 20:60580079-60580101 ACATCCTGGTTCAGGCTGAGTGG - Intergenic
1175988184 20:62774676-62774698 CCTTCCAGGCAGGGGCTGAGGGG + Intergenic
1176195479 20:63834870-63834892 CCATCCTTCCTGAGGATGAGAGG - Intergenic
1177150398 21:17449907-17449929 CCAAGCTGGCTGAGGCTGACTGG - Intergenic
1177454773 21:21322599-21322621 ACTTCCTGGCTGTGCTTGAGTGG + Intronic
1178441837 21:32604693-32604715 CCTTCCTGCCCCATGCTGAGGGG - Intronic
1179725520 21:43339503-43339525 CCTTGTAGGCAGAGGCTGAGGGG - Intergenic
1179883253 21:44302139-44302161 GCTTCCTGGCTGCAGCTGGGAGG + Intronic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181031246 22:20149698-20149720 CCCGCCTGGCTGAGGGGGAGGGG - Intronic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1181477188 22:23176000-23176022 CCTGCCTGCGTGAGGCTGGGTGG - Intergenic
1181512092 22:23393699-23393721 CCCGCCTGGCTGAGGGGGAGGGG + Intergenic
1181532827 22:23526738-23526760 CCTTCCTGGCTGAGGCGGCTGGG - Intergenic
1182449684 22:30411885-30411907 CCTTCCTAGCTCAGGTGGAGTGG - Intronic
1183212272 22:36458276-36458298 CCGGCCTGGCTGTGGCTCAGTGG + Intergenic
1183344646 22:37300621-37300643 CCTTCCCAGCTGAGGCAGACTGG + Intronic
1183365903 22:37406709-37406731 ACTTCCTGGGGGAGGCTGAGGGG + Intronic
1183371593 22:37435611-37435633 CCTTCCTACCAGGGGCTGAGTGG + Intergenic
1183465458 22:37978087-37978109 CCTTCATCGAGGAGGCTGAGCGG - Exonic
1184098224 22:42328149-42328171 CCTGCATGGCTGAGCCTGGGAGG - Intronic
1184190440 22:42891124-42891146 CCTTCATGTCCGAGGCAGAGAGG - Exonic
1185136935 22:49078668-49078690 GCTTCCTGGCTAAGGCCAAGGGG - Intergenic
1185253027 22:49815615-49815637 CCTTCCTGGTGCAGGCTGACAGG - Intronic
950477087 3:13221314-13221336 CCCTTCTGGCTGAGACAGAGGGG - Intergenic
950575585 3:13830280-13830302 CCCTCCAGCCTGAGGTTGAGGGG - Intronic
951682871 3:25312784-25312806 TCCTCCTGGCTGTGGCTGCGTGG - Intronic
952301868 3:32110577-32110599 CCTTCCTGGCTGAAGCTCCCTGG - Intronic
952669023 3:35943926-35943948 TCTGCCTGGCTGAGGATGTGTGG + Intergenic
952751186 3:36826246-36826268 CCTTCCTGCCTGCTGCAGAGTGG - Intergenic
952822834 3:37499672-37499694 CCCTCAGGGCTGAGGCTGAAGGG - Intronic
952980115 3:38727510-38727532 ACTTCCTGTCTGAGGGTGAGGGG + Intronic
953355052 3:42248826-42248848 GCTGCATGGCTGAAGCTGAGTGG + Intergenic
953540413 3:43813073-43813095 CCTTCCTGACTGAGGCAGCTGGG - Intergenic
954779129 3:53046206-53046228 CCCTCCTGGCTGGGGCCGCGCGG + Intronic
955014934 3:55061032-55061054 CCTTGTGGGCTGAGGATGAGTGG + Intronic
956249559 3:67221475-67221497 CCTTCCAGGCTGAGGAGGAGTGG + Intergenic
956571662 3:70703488-70703510 CCTGCCTGGCTGTGGCCGGGAGG - Intergenic
960590109 3:119357406-119357428 CATTCCTGTGTGGGGCTGAGAGG + Intronic
961388950 3:126541058-126541080 TCTACATGGCTGAGGCTGCGAGG + Intronic
961451714 3:127005197-127005219 CCTCCCGGGCGGAGGGTGAGCGG - Exonic
961803300 3:129469356-129469378 ACATCCTGGCTGTGGCTGACTGG + Exonic
963601901 3:147385767-147385789 CTTTCCTGGCAGACACTGAGAGG + Intergenic
966847952 3:184145039-184145061 CCATCCAGGCTGAGACTGAAAGG + Exonic
967274857 3:187764423-187764445 CCTTGTTGCCTGAGGCTGTGGGG - Intergenic
967287034 3:187881996-187882018 TCTTCCTGGCTGACACTAAGAGG + Intergenic
967788449 3:193522253-193522275 CCTTCCTGCCTGCAGCTGATAGG - Intronic
968437396 4:601033-601055 GCTGCCTGGCTGTGGGTGAGGGG - Intergenic
968642495 4:1721590-1721612 CCTTCCTGGCGGCGGCGGCGCGG + Exonic
969037683 4:4268363-4268385 CCACCCTGGCTGAGGCTGTGTGG + Intronic
969210596 4:5684349-5684371 CCTTCCACCCTGAGGCTGCGAGG - Intronic
970131301 4:12874934-12874956 CCTTCCTGGGCCTGGCTGAGTGG + Intergenic
970615281 4:17763119-17763141 CCTTGCTGGCTGGGGTTGACAGG - Intronic
974836316 4:67255328-67255350 CCTTCCTGGTCTAGTCTGAGAGG + Intergenic
975428829 4:74263719-74263741 GCTTTCTGGCTGAGACTGTGGGG + Intronic
977501463 4:97844254-97844276 CATTCCTTTCTGTGGCTGAGGGG - Intronic
978377179 4:108086994-108087016 TTTTTCTGGCTGAGGCGGAGGGG + Intronic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
980807456 4:137831821-137831843 CCTTCCTGGCAGAGTCTGCCAGG + Intergenic
982170250 4:152655238-152655260 CCTTCTTGGCTGAGACTGGCTGG + Intronic
984050636 4:174860717-174860739 CATTCCTGGCTTAGTCTGTGGGG + Intronic
984501004 4:180558562-180558584 CATACCTGGCTGTGGCTGAGGGG + Intergenic
985645688 5:1083731-1083753 TCTTCCTGGGTGAGGCTCACAGG - Exonic
985778528 5:1857728-1857750 CCCTCCTGGCTCTGGCTGAGCGG - Intergenic
987250437 5:16095341-16095363 CCCTCCTCGCTGAAGCTTAGAGG - Intronic
987962085 5:24823838-24823860 CCTGCCTCCCTGGGGCTGAGTGG - Intergenic
988046593 5:25963341-25963363 CCAACCTGGCTAAGGCTGACTGG - Intergenic
988513379 5:31884484-31884506 CTGCCCTGGCTGAGGCTGAATGG - Intronic
990177906 5:53127952-53127974 CCAGGCTGGCTGAGGCTGCGGGG + Intergenic
990571323 5:57081998-57082020 CCTTCCTGGCTGATGGAGAAAGG + Intergenic
991495493 5:67221832-67221854 GCTTCCTGTCTGAGGCTTTGTGG - Intergenic
992546254 5:77816873-77816895 CCTTCCTGGCAGTGGCAGAGGGG - Intronic
995627352 5:114093627-114093649 CATTCCTGGCGGAAGGTGAGGGG + Intergenic
996570624 5:124929363-124929385 CAGTGCTGGCTGAGGCTGTGTGG + Intergenic
996886007 5:128354311-128354333 CCAGTCTGGCTCAGGCTGAGGGG + Intronic
997196097 5:131980975-131980997 GAGTCCTGGCTGAGGATGAGAGG - Intronic
997383832 5:133457017-133457039 CCATCCTTGCTGAGGGTCAGAGG - Intronic
997615025 5:135240314-135240336 GCTTCCTGGAGGAGGCTGGGTGG + Intronic
997710792 5:136002383-136002405 CCTTCCTGGGTGATCTTGAGCGG - Intergenic
997849367 5:137317098-137317120 ACTGCTTGGCTGAGGCAGAGGGG + Intronic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
998504365 5:142660276-142660298 CCTTCCAGTCAGAGGCTGAGTGG - Intronic
999181841 5:149675371-149675393 CCTTCCTTGGAGAGGCTGATAGG - Intergenic
999193136 5:149763437-149763459 CTGTCCTGGCTGTGGCTGAGTGG + Intronic
999347790 5:150839789-150839811 CCTGCCTTGCTGTGGCTGAGTGG + Intergenic
999673642 5:153978217-153978239 CCTTCCAAACTCAGGCTGAGTGG - Intergenic
1000549758 5:162646406-162646428 CCTTCCTGGATGACTATGAGGGG - Intergenic
1000947531 5:167439756-167439778 TCTTCCTGGCTTTGTCTGAGAGG - Intronic
1001021840 5:168189678-168189700 CCTTCCTGGCTTAGAGAGAGTGG + Intronic
1001444580 5:171773490-171773512 CCCTCCTGTCTGGGGCTGTGTGG - Intergenic
1001938818 5:175726960-175726982 CCTTCTTGCCTGGGTCTGAGGGG - Intergenic
1002701879 5:181130376-181130398 CCTTGCTCTCTGAGCCTGAGGGG - Intergenic
1002762853 6:215162-215184 CCCTCCTGGGTGATGCTGTGAGG + Intergenic
1002890413 6:1326944-1326966 CCCTCCTGGAGGAGGCTCAGGGG + Intergenic
1004169096 6:13281944-13281966 GCTTCCTGCCTTTGGCTGAGAGG + Intronic
1007945881 6:45826774-45826796 TCTACCTGGCTCAGGCTGTGGGG - Intergenic
1014775071 6:125499288-125499310 CCTTCCTGGATGACTTTGAGGGG - Intergenic
1016378062 6:143444300-143444322 CCTGCCATGCTGAGGATGAGTGG + Intronic
1016923421 6:149317764-149317786 CGCTCCTGGCTGAGGGGGAGGGG - Intronic
1017399121 6:154039397-154039419 CAGTCCTGGCTGAGACAGAGAGG - Exonic
1017564236 6:155667069-155667091 CCTTCTTGGCTGAGAATGACGGG - Intergenic
1018967241 6:168498592-168498614 CCTTCCTGCTGCAGGCTGAGTGG + Intronic
1019047004 6:169156947-169156969 ACTAGCTGGCTGAGGCTCAGGGG - Intergenic
1019383508 7:740575-740597 CCCTCCTGGCTGGGCCGGAGAGG - Intronic
1019477778 7:1252277-1252299 ACTGCCTGGCTCAGGCTGGGAGG + Intergenic
1019803811 7:3107842-3107864 CCTTCCTGCCTGGGGATGAGAGG + Intergenic
1020756653 7:12211459-12211481 CCTTCCGGAGCGAGGCTGAGCGG + Intronic
1021508666 7:21411759-21411781 CCCTCCAGGCTGGGGCTGTGAGG - Intergenic
1023970247 7:44985670-44985692 CCTTTCTGGCTGAGGAAGAAGGG + Intergenic
1025898201 7:65723215-65723237 CCCTCCTGCAAGAGGCTGAGTGG - Intergenic
1026641989 7:72135161-72135183 CCTTCATGGATGATGTTGAGGGG - Intronic
1026882923 7:73919068-73919090 GCTTCCTGGAGGAGGCGGAGTGG + Intergenic
1030014084 7:105201072-105201094 CAGTCCTGGCAGAGGGTGAGGGG + Intronic
1030623325 7:111816137-111816159 CTTTCCTGGATGAGAGTGAGAGG - Intronic
1032735859 7:134692165-134692187 CCAGGCTGGCTGATGCTGAGTGG + Intergenic
1033227852 7:139575123-139575145 CTTACCTGGCTGAGATTGAGTGG + Exonic
1033258464 7:139821833-139821855 CCTTCCTGGCTTTGGCAAAGTGG - Intronic
1034357978 7:150468401-150468423 CACTCCTGGCTGAGTGTGAGGGG + Intronic
1034478722 7:151303678-151303700 CCTTCCCGGCTGCTGCTCAGCGG - Intergenic
1035542542 8:453094-453116 CCTTCTGTGCTGAGGCAGAGAGG - Intronic
1036762052 8:11516071-11516093 CCTTCCTTTCAAAGGCTGAGTGG - Intronic
1036993441 8:13627088-13627110 CCTTCCTGGGTGGGACTCAGGGG - Intergenic
1038537138 8:28361216-28361238 CCTTCCTGGCTCCTGCTGTGTGG - Intronic
1038660159 8:29490215-29490237 TGTTCCTGCTTGAGGCTGAGAGG - Intergenic
1039339047 8:36626794-36626816 CCCTCCATGGTGAGGCTGAGTGG + Intergenic
1040278270 8:46024910-46024932 CCTTCCTGGCAGCCTCTGAGTGG - Intergenic
1041107844 8:54459097-54459119 CCTTCGTGGAGGAGGCAGAGCGG + Exonic
1041438400 8:57867126-57867148 CCTTGCTGGTGGAGGCCGAGTGG + Intergenic
1042754559 8:72196419-72196441 CTTTCCTTGCTGTGGGTGAGTGG + Intergenic
1047039518 8:120977342-120977364 CTTTCCTAACTGAGGCTGGGAGG - Intergenic
1049107886 8:140624987-140625009 CCTTCCTGGAGGAGGCTGCTGGG - Intronic
1049358697 8:142201614-142201636 CCTTCCAGGGGGAGGCTGGGGGG - Intergenic
1049452350 8:142669092-142669114 CCGTCCTGTGTGAGGCTAAGAGG + Intronic
1049584279 8:143425753-143425775 CCTTCCTGGAGGAGGCTGCCTGG - Intronic
1049802872 8:144526383-144526405 CCTTCCTGGGGGAGGCTGAGTGG - Exonic
1053146614 9:35716477-35716499 CCATCAAGGCTGATGCTGAGGGG - Exonic
1053271365 9:36751907-36751929 CCTTCTGGGTTGAGGCTAAGTGG + Intergenic
1054770492 9:69078811-69078833 GCATCCAGGCAGAGGCTGAGTGG - Intronic
1054817840 9:69492571-69492593 CATTACTGGCTAAGGCTGGGGGG + Intronic
1057014729 9:91641943-91641965 CCTCCCTTGCTGAGGTAGAGGGG - Intronic
1057941568 9:99289624-99289646 CCCTCCAGGATGGGGCTGAGAGG - Intergenic
1057943743 9:99306640-99306662 CCCTCCTGGCTGACCCAGAGCGG + Intergenic
1058190220 9:101905314-101905336 CCTTCCGGGCTGATGGGGAGTGG + Intergenic
1059259764 9:112964253-112964275 TCTTCCTGGGTCATGCTGAGGGG + Intergenic
1059464608 9:114460002-114460024 CCATCCTGGCTGAGGCTCCTTGG - Intronic
1060047520 9:120352299-120352321 TGTTCCTGGGAGAGGCTGAGAGG - Intergenic
1060934779 9:127508587-127508609 CCTTCCTGGGTGCCGCTGAGGGG + Intronic
1061181543 9:129027803-129027825 CCTGCCTGGCTGAGGAGGGGAGG - Intronic
1061375065 9:130219387-130219409 GCTTCCGGGCTGTTGCTGAGAGG + Intronic
1062056617 9:134472377-134472399 CCTGCCTGGCTGTCCCTGAGGGG + Intergenic
1062495105 9:136827928-136827950 CCTTGATGGCGGAGGCTCAGGGG + Intronic
1062556579 9:137115620-137115642 CCATCCTGTGTGGGGCTGAGCGG + Intergenic
1186845224 X:13524043-13524065 CCTTCATGGCAGAGTCTGACAGG + Intergenic
1187044037 X:15627986-15628008 CCTTCATGACAGAGGATGAGAGG - Exonic
1187169416 X:16836607-16836629 CCCTGCTGGCTGTGGCTGGGCGG + Intronic
1189201226 X:39197253-39197275 CCTTCATGGCAGAGGCTGGATGG + Intergenic
1191904719 X:66076273-66076295 ACTTTCTGGCTGAGGATGGGAGG - Intergenic
1192209955 X:69121695-69121717 CCCTCCTCCTTGAGGCTGAGGGG + Intergenic
1195748373 X:108140413-108140435 CCTTACTGTTTGAGGTTGAGTGG + Intronic
1195927976 X:110045557-110045579 CCTCCCTGGCTTAGGTTGATTGG + Intronic
1196899522 X:120368989-120369011 CACTCCTGGGTGAGGCTAAGGGG + Intronic
1198532598 X:137560795-137560817 CCTTCCTCGCTGAGGGGCAGAGG - Intergenic
1198936195 X:141904253-141904275 CCCAGGTGGCTGAGGCTGAGCGG + Intronic
1199643054 X:149881819-149881841 CCTACCTGTCTGAGACTGAGGGG + Intronic
1199978991 X:152910880-152910902 TCTTCCTGGCTGTCACTGAGTGG + Intergenic
1200119548 X:153783870-153783892 CCACCCAGGCTGAGGGTGAGGGG + Exonic
1200827382 Y:7658831-7658853 CAATCCTGGCTGACCCTGAGTGG - Intergenic
1200909185 Y:8515759-8515781 CAATCCTGGCTGACCCTGAGTGG + Intergenic
1200986154 Y:9304853-9304875 CAGTCCTGGCTGACCCTGAGTGG - Intergenic
1201343454 Y:12957907-12957929 ACTTCCTCCCTGAGGCTGAGCGG + Intergenic
1201553523 Y:15244177-15244199 TCTTCCTCGCTAAGGCTGGGTGG - Intergenic
1202087377 Y:21153158-21153180 CCTCACTGCCTGAGGCTGTGGGG + Intergenic
1202124429 Y:21556049-21556071 CAGTCCTGGCTGACCCTGAGTGG + Intergenic
1202154579 Y:21873331-21873353 CAGTCCTGGCTGACCCTGAGTGG - Intergenic
1202269877 Y:23061254-23061276 TCTTCCTGGCACAGCCTGAGTGG - Intergenic
1202422871 Y:24695000-24695022 TCTTCCTGGCACAGCCTGAGTGG - Intergenic
1202447918 Y:24975086-24975108 TCTTCCTGGCACAGCCTGAGTGG + Intergenic