ID: 1104847554

View in Genome Browser
Species Human (GRCh38)
Location 12:131854258-131854280
Sequence AGAACCGAGGTCCCATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 37}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104847554_1104847556 -9 Left 1104847554 12:131854258-131854280 CCTCGTGATGGGACCTCGGTTCT 0: 1
1: 0
2: 0
3: 5
4: 37
Right 1104847556 12:131854272-131854294 CTCGGTTCTGTGTCTTCAGCAGG 0: 1
1: 0
2: 0
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104847554 Original CRISPR AGAACCGAGGTCCCATCACG AGG (reversed) Intergenic
903928837 1:26850639-26850661 GGAACTGAGGTCCCTTCACTGGG + Intronic
923228005 1:231957130-231957152 ACAACCCAGGTCCAATCAAGCGG - Intronic
1066207085 10:33199970-33199992 AGAACTGAGGTACCATGACTTGG - Intronic
1069771539 10:70903606-70903628 TGCACCCAGGTCCCAGCACGGGG - Intergenic
1078527084 11:12109747-12109769 GGAACCCAGGGCCCATCACAGGG - Intronic
1084565608 11:69926796-69926818 AAAGCCGAGGTCCCTTCCCGGGG + Intergenic
1086056139 11:82649363-82649385 AGAACTGGGGTTCCATCACTTGG - Intergenic
1090830263 11:130416238-130416260 CGAACAGCGGTGCCATCACGTGG + Exonic
1092916207 12:13191600-13191622 GGAACCGAGATCCCATTACTCGG + Intergenic
1094854164 12:34395535-34395557 ACAACAGAGGTCCCAACCCGCGG + Intergenic
1104847554 12:131854258-131854280 AGAACCGAGGTCCCATCACGAGG - Intergenic
1119309389 14:73633825-73633847 CCAGCCCAGGTCCCATCACGTGG + Intergenic
1123153765 14:106205824-106205846 GGAACCCAAGTCCCCTCACGGGG - Intergenic
1126198269 15:45955672-45955694 AGAGCCGAGGTGCCAACACCTGG - Intergenic
1132224867 15:100132565-100132587 AGAACCAAGGTTCCCTCACGTGG - Intronic
1137760021 16:50933171-50933193 AGAAACTTGGCCCCATCACGTGG + Intergenic
1138148277 16:54631641-54631663 TCAACCGAGGTCCCATCATGAGG + Intergenic
1144375581 17:14636551-14636573 AGAACCCAGTTCCCACCAGGTGG - Intergenic
1147884885 17:43677762-43677784 AGAACCCAGGTCGCAGGACGGGG + Intergenic
1151291762 17:73155741-73155763 AGTGGCCAGGTCCCATCACGAGG + Intergenic
1152590750 17:81210714-81210736 AGACCCGAGGTCCCATCCTGTGG - Intronic
1154102596 18:11489854-11489876 AGAACCTAGGTCCCTTCATGGGG + Intergenic
1165761827 19:38326136-38326158 AGGACAGAGGTGCCATCACCTGG + Intronic
1166972085 19:46575752-46575774 AGAGACAAGGTCCCATCATGTGG - Intronic
1168072460 19:53960573-53960595 AGAACCTAGGTCCCAGTACAGGG - Intergenic
928591927 2:32826099-32826121 AGAACCAAGTTCCCATCATTAGG + Intergenic
932869417 2:75382041-75382063 AAAACCGTAGTCCCATCATGAGG - Intergenic
935369785 2:102333136-102333158 AGAACCTAGGTCAAATCAAGGGG - Intronic
946941010 2:224770249-224770271 AGAACTGAGGTCCCACTACAAGG - Exonic
1172095077 20:32456585-32456607 AGAACAGAGGGGCCATCAGGAGG + Intronic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1179259870 21:39748588-39748610 AGGACCTGAGTCCCATCACGAGG + Intronic
953411510 3:42692952-42692974 AGAAGGGAGGGCCCATCAAGCGG - Intronic
956725422 3:72152731-72152753 AGAACCGGTGTCCCAGCACCAGG + Intergenic
1022425097 7:30261273-30261295 AGAACAGTGATCCCATCATGGGG + Intergenic
1040987557 8:53313119-53313141 AGAACCGAGATCTCATCACCAGG - Intergenic
1041868096 8:62599686-62599708 AGATCTGAGGTCCTATCACAAGG - Intronic
1046648444 8:116810839-116810861 GGAAATGAGGTCCCATCTCGGGG + Intronic
1049338428 8:142098992-142099014 AGAATCGAGGTCCCAGCCCCAGG + Intergenic
1188722711 X:33543300-33543322 AGAGCCTAGCTCCCATCAGGTGG + Intergenic
1196463001 X:115948617-115948639 AGAACCAATGTCCCATCTGGAGG + Intergenic
1199087480 X:143644783-143644805 AGAACCATGGTCCCCTCACAGGG - Intergenic
1200249024 X:154542369-154542391 ATCATCGAGGTCCCATCAGGTGG + Exonic