ID: 1104849116

View in Genome Browser
Species Human (GRCh38)
Location 12:131862848-131862870
Sequence AGTGAAACTGCCCCATGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104849116_1104849125 22 Left 1104849116 12:131862848-131862870 CCATCACATGGGGCAGTTTCACT No data
Right 1104849125 12:131862893-131862915 CCTCTATTCATCCCACCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104849116 Original CRISPR AGTGAAACTGCCCCATGTGA TGG (reversed) Intergenic
No off target data available for this crispr