ID: 1104849243

View in Genome Browser
Species Human (GRCh38)
Location 12:131863379-131863401
Sequence AGCAACAAAGCCGCCCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104849243_1104849246 14 Left 1104849243 12:131863379-131863401 CCTGCGGGGGCGGCTTTGTTGCT No data
Right 1104849246 12:131863416-131863438 CACAGAACCGCCTTTGCCTGGGG No data
1104849243_1104849249 21 Left 1104849243 12:131863379-131863401 CCTGCGGGGGCGGCTTTGTTGCT No data
Right 1104849249 12:131863423-131863445 CCGCCTTTGCCTGGGGCTGGAGG No data
1104849243_1104849244 12 Left 1104849243 12:131863379-131863401 CCTGCGGGGGCGGCTTTGTTGCT No data
Right 1104849244 12:131863414-131863436 TGCACAGAACCGCCTTTGCCTGG No data
1104849243_1104849250 22 Left 1104849243 12:131863379-131863401 CCTGCGGGGGCGGCTTTGTTGCT No data
Right 1104849250 12:131863424-131863446 CGCCTTTGCCTGGGGCTGGAGGG No data
1104849243_1104849247 18 Left 1104849243 12:131863379-131863401 CCTGCGGGGGCGGCTTTGTTGCT No data
Right 1104849247 12:131863420-131863442 GAACCGCCTTTGCCTGGGGCTGG No data
1104849243_1104849245 13 Left 1104849243 12:131863379-131863401 CCTGCGGGGGCGGCTTTGTTGCT No data
Right 1104849245 12:131863415-131863437 GCACAGAACCGCCTTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104849243 Original CRISPR AGCAACAAAGCCGCCCCCGC AGG (reversed) Intergenic