ID: 1104849624

View in Genome Browser
Species Human (GRCh38)
Location 12:131865790-131865812
Sequence CTTTTTGTAGAGATTGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104849624_1104849629 10 Left 1104849624 12:131865790-131865812 CCGCCCCCAATCTCTACAAAAAG No data
Right 1104849629 12:131865823-131865845 AATAAAACAGCCAGTCATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104849624 Original CRISPR CTTTTTGTAGAGATTGGGGG CGG (reversed) Intergenic
No off target data available for this crispr