ID: 1104850971

View in Genome Browser
Species Human (GRCh38)
Location 12:131873564-131873586
Sequence CAGCAAGCAGCAGTGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104850959_1104850971 24 Left 1104850959 12:131873517-131873539 CCCTGCCGGATCCAGAGGGGTGG 0: 12
1: 57
2: 117
3: 172
4: 193
Right 1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG No data
1104850964_1104850971 13 Left 1104850964 12:131873528-131873550 CCAGAGGGGTGGAAGTCAGCGGC 0: 21
1: 71
2: 115
3: 97
4: 145
Right 1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG No data
1104850955_1104850971 30 Left 1104850955 12:131873511-131873533 CCGACACCCTGCCGGATCCAGAG No data
Right 1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG No data
1104850962_1104850971 19 Left 1104850962 12:131873522-131873544 CCGGATCCAGAGGGGTGGAAGTC 0: 28
1: 72
2: 82
3: 94
4: 145
Right 1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG No data
1104850961_1104850971 23 Left 1104850961 12:131873518-131873540 CCTGCCGGATCCAGAGGGGTGGA 0: 12
1: 51
2: 119
3: 150
4: 212
Right 1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104850971 Original CRISPR CAGCAAGCAGCAGTGGTGGA TGG Intergenic
No off target data available for this crispr