ID: 1104851969

View in Genome Browser
Species Human (GRCh38)
Location 12:131880556-131880578
Sequence TGGCATTCAGCAGTGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104851963_1104851969 19 Left 1104851963 12:131880514-131880536 CCGGACCTGGACAGGTGGAAGTC No data
Right 1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG No data
1104851960_1104851969 24 Left 1104851960 12:131880509-131880531 CCCTGCCGGACCTGGACAGGTGG No data
Right 1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG No data
1104851964_1104851969 14 Left 1104851964 12:131880519-131880541 CCTGGACAGGTGGAAGTCAGCAG No data
Right 1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG No data
1104851962_1104851969 23 Left 1104851962 12:131880510-131880532 CCTGCCGGACCTGGACAGGTGGA No data
Right 1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG No data
1104851958_1104851969 30 Left 1104851958 12:131880503-131880525 CCGACACCCTGCCGGACCTGGAC No data
Right 1104851969 12:131880556-131880578 TGGCATTCAGCAGTGGTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104851969 Original CRISPR TGGCATTCAGCAGTGGTGGA CGG Intergenic
No off target data available for this crispr