ID: 1104859225

View in Genome Browser
Species Human (GRCh38)
Location 12:131916069-131916091
Sequence GCAGTCCTGCCGGAACCTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 120}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104859215_1104859225 0 Left 1104859215 12:131916046-131916068 CCTCCCCAGCCGTCCCACGGCCT 0: 1
1: 0
2: 1
3: 24
4: 328
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859212_1104859225 5 Left 1104859212 12:131916041-131916063 CCAGCCCTCCCCAGCCGTCCCAC 0: 1
1: 0
2: 6
3: 77
4: 850
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859217_1104859225 -4 Left 1104859217 12:131916050-131916072 CCCAGCCGTCCCACGGCCTGCAG 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859218_1104859225 -5 Left 1104859218 12:131916051-131916073 CCAGCCGTCCCACGGCCTGCAGT 0: 1
1: 0
2: 0
3: 15
4: 152
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859209_1104859225 16 Left 1104859209 12:131916030-131916052 CCCACCACAGGCCAGCCCTCCCC 0: 1
1: 0
2: 6
3: 64
4: 649
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859211_1104859225 12 Left 1104859211 12:131916034-131916056 CCACAGGCCAGCCCTCCCCAGCC 0: 1
1: 2
2: 11
3: 179
4: 1296
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859214_1104859225 1 Left 1104859214 12:131916045-131916067 CCCTCCCCAGCCGTCCCACGGCC 0: 1
1: 0
2: 0
3: 52
4: 427
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859210_1104859225 15 Left 1104859210 12:131916031-131916053 CCACCACAGGCCAGCCCTCCCCA 0: 1
1: 0
2: 5
3: 97
4: 725
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859216_1104859225 -3 Left 1104859216 12:131916049-131916071 CCCCAGCCGTCCCACGGCCTGCA 0: 1
1: 0
2: 1
3: 22
4: 230
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120
1104859219_1104859225 -9 Left 1104859219 12:131916055-131916077 CCGTCCCACGGCCTGCAGTCCTG 0: 1
1: 0
2: 3
3: 20
4: 306
Right 1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG 0: 1
1: 0
2: 0
3: 16
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104859225 Original CRISPR GCAGTCCTGCCGGAACCTGC GGG Exonic
901066444 1:6496892-6496914 GCAGCCCTGCCGGGACCCCCTGG - Intronic
901511273 1:9719151-9719173 GTGGTCCTGCAGGAACCTGCAGG + Intronic
902627211 1:17683540-17683562 GGAGTCCTGCCTGAGCCTCCTGG - Intronic
903860892 1:26363882-26363904 GAAGCCCTGCTGGATCCTGCAGG - Intronic
905663199 1:39744372-39744394 CCAGTCCTACGGGAACCTGCTGG + Intronic
906322126 1:44823349-44823371 CCAGGGCAGCCGGAACCTGCGGG - Exonic
906415050 1:45615041-45615063 CCAGTCCTGCCTTAACCTGCAGG + Exonic
908189209 1:61684080-61684102 ACAGTCCTGCCAGAACCACCTGG + Intronic
918143575 1:181737518-181737540 GCAGGCCCTCCGGATCCTGCGGG - Exonic
920920619 1:210294644-210294666 ACAGTCCTGACAGATCCTGCAGG - Intergenic
921174402 1:212581224-212581246 GCAGGTCTGCCGGCCCCTGCAGG + Intronic
921703611 1:218294595-218294617 GCCGTCCTGCAGGAACCTCCAGG + Intronic
1070695105 10:78557270-78557292 ACATTCCTGAGGGAACCTGCTGG - Intergenic
1073170312 10:101501100-101501122 GCAGAATTGCCTGAACCTGCGGG + Intronic
1073454051 10:103626053-103626075 GCAGCCCAGCCTGAACATGCGGG + Intronic
1075625717 10:123963180-123963202 GCTGTCCTGCCTTACCCTGCGGG + Intergenic
1076258286 10:129045814-129045836 GCCGTCCTGCAGCAACCAGCCGG + Intergenic
1076717391 10:132373295-132373317 TCTCTCCTGCTGGAACCTGCCGG - Intronic
1076883691 10:133251851-133251873 GCAGTCCAGCCAGCACCAGCCGG + Intergenic
1077539521 11:3139952-3139974 GCAGGCCTGCCAGGAGCTGCAGG - Intronic
1080892443 11:36421139-36421161 TCAGTCCTGGAGAAACCTGCTGG + Intronic
1081677272 11:44977722-44977744 GGAGTCCTGCAGAAACCTTCGGG - Intergenic
1082947688 11:58777050-58777072 GCAGTCGTGCAGGAACTCGCTGG - Intergenic
1083777108 11:64899452-64899474 GCTGTGCTGCAAGAACCTGCGGG - Intronic
1085040850 11:73325405-73325427 GGAGCCCTGCTGGAGCCTGCGGG + Intronic
1086886462 11:92211608-92211630 GCAGTCCTGTGGCAACCTGCTGG - Intergenic
1089565217 11:119367688-119367710 GCAGTCTGGCCTGAACCAGCTGG + Intronic
1096700963 12:53382418-53382440 GTAGTCCTGTCAGAACTTGCTGG - Exonic
1102352118 12:112200686-112200708 GCAGTCCTTCGGTAGCCTGCTGG + Exonic
1102425783 12:112843427-112843449 GCAGCCCTGCTGGAGGCTGCTGG - Intronic
1102788571 12:115624212-115624234 GCCGTCCTGCCGGCATCTCCCGG + Intergenic
1103735232 12:123056837-123056859 AAAGTCCTGCAGGGACCTGCAGG - Intronic
1104859225 12:131916069-131916091 GCAGTCCTGCCGGAACCTGCGGG + Exonic
1105420434 13:20247488-20247510 GCAGACCTGCAGACACCTGCAGG - Intergenic
1105889081 13:24669151-24669173 GCTGTTCAGCAGGAACCTGCAGG - Intergenic
1106185338 13:27404896-27404918 GACTTCCTGCCGGGACCTGCTGG - Intergenic
1108114479 13:47111669-47111691 GCAGCCGTGCAGGAACTTGCTGG + Intergenic
1109517048 13:63457323-63457345 GCAGTCTTGCCAGAATCTGTAGG + Intergenic
1110573191 13:77027480-77027502 GGAGTCTCGCCGGAGCCTGCTGG + Intergenic
1113879326 13:113614809-113614831 GCCGTCAGGGCGGAACCTGCAGG + Intronic
1122206750 14:100151477-100151499 GCAGTCCAGCAGGTGCCTGCAGG - Intronic
1129159541 15:73739701-73739723 GCAGTCCTGCCCACACCTCCTGG + Exonic
1132321607 15:100929690-100929712 GGATTCCTGCCTGAACGTGCTGG + Intronic
1132698102 16:1210828-1210850 GCAGAGCAGCTGGAACCTGCTGG + Exonic
1133756641 16:8767137-8767159 GCAGTTCTGCCTGAATCAGCTGG + Intronic
1137394868 16:48109792-48109814 GCACTCCTGCCCCAGCCTGCGGG - Intronic
1137722161 16:50633598-50633620 GCAGGGCTGCCGGGGCCTGCAGG + Exonic
1139446278 16:67000631-67000653 GGACTCCTGCAGGCACCTGCGGG - Exonic
1141421203 16:83917704-83917726 TCAGGCCTGCGGAAACCTGCTGG + Exonic
1141848807 16:86630059-86630081 GGAGAGCTGCTGGAACCTGCAGG + Intergenic
1142160258 16:88553884-88553906 GCAGCCCTGCAGGAACCCACCGG - Intergenic
1143038769 17:4016935-4016957 GCAAGCCTGCCAGCACCTGCAGG + Intronic
1147599847 17:41738858-41738880 GCAGTCCTGCTGTCTCCTGCAGG + Intergenic
1148854028 17:50568960-50568982 CCAGCGCTGCCGGATCCTGCAGG + Exonic
1150313126 17:64145979-64146001 CCTGACCTCCCGGAACCTGCAGG - Intergenic
1151476510 17:74347171-74347193 GCAGTCATGACGGCAGCTGCTGG - Intronic
1151682317 17:75628656-75628678 TCATCCCTGCCGGCACCTGCTGG + Exonic
1151989435 17:77564767-77564789 GCAGCGATGACGGAACCTGCAGG + Intergenic
1152029230 17:77831276-77831298 GCAGTCCTGCCAGAACCTTTGGG - Intergenic
1152308218 17:79533470-79533492 ACAGTCATGCCAGAACCTGGAGG - Intergenic
1152921812 17:83069594-83069616 CCAGTCCTTCCCCAACCTGCTGG + Intergenic
1157223302 18:45841979-45842001 GCAGTGCGGCTGGAACCGGCAGG - Intronic
1159909858 18:74135424-74135446 GCAGCACTGCAGGGACCTGCTGG - Intronic
1160956012 19:1692010-1692032 GCAGTCCTTCCGGAAGGAGCCGG + Intergenic
1162158872 19:8697501-8697523 CCAGTCCTGCTGGGTCCTGCGGG - Exonic
1163692719 19:18746030-18746052 GCAGCCCTGTCAGAACCTGCTGG - Intronic
1165075128 19:33276214-33276236 ACAGGCCTGCTGGAGCCTGCCGG + Intergenic
1165762033 19:38327098-38327120 GCAGTTCTACTGGACCCTGCAGG - Intronic
1166510601 19:43406391-43406413 ACAGGCTTGGCGGAACCTGCGGG + Exonic
1168257598 19:55175189-55175211 GCAGGCCTGGCGGGAGCTGCAGG - Exonic
925154415 2:1638773-1638795 ACAGCCCTGCCCGAACCTTCTGG - Intronic
925287635 2:2726420-2726442 GCACTGCTGCCTGCACCTGCAGG + Intergenic
927256403 2:21044053-21044075 GCATTCCCACCGGGACCTGCGGG - Exonic
929581506 2:43084315-43084337 GCAATCCTGCTGGAGCCTGCAGG - Intergenic
932231416 2:70087113-70087135 GCAGCCCCGGCGGAAACTGCAGG - Intergenic
932404767 2:71505678-71505700 CCAGTCCTGGAGGAACCTCCAGG + Intronic
932424610 2:71621083-71621105 GGAGCCCTGCTGGAAACTGCAGG - Intronic
937280812 2:120716117-120716139 GCAGTCCTGGCCAAGCCTGCAGG + Intergenic
937810461 2:126194280-126194302 CCAGCTCTGCTGGAACCTGCAGG + Intergenic
938133162 2:128734496-128734518 GCAGTCGTGGCCGCACCTGCGGG + Intergenic
945056401 2:205873047-205873069 CCAGTCCTGCTGGTACATGCTGG - Intergenic
945442224 2:209893997-209894019 CCAGTCCTGCAGGAACCACCAGG - Intronic
947841563 2:233211086-233211108 GCAGTCCTGCCTCATTCTGCAGG + Intronic
948536853 2:238652983-238653005 GCTCTCCTGCCGGGACCTGCAGG - Intergenic
1171030782 20:21674675-21674697 GGAGACCTGCCGCAACCTCCAGG + Intergenic
1175933256 20:62503312-62503334 GAAGTCCTGCCGGGACCTCTAGG - Intergenic
1181875323 22:25935926-25935948 GCAGTCCTGGCTCACCCTGCGGG + Intronic
1182367553 22:29789169-29789191 GCTGTCATGCCGGTACCTGAGGG + Exonic
1183428019 22:37750084-37750106 TCAGTCCTGTCGGAAGCTGCGGG + Intronic
1183678244 22:39311806-39311828 GCAGGCCTGCCAGACACTGCTGG + Intergenic
1183907092 22:41049734-41049756 GCAGCCCTGCAGGAACATGTGGG + Intergenic
1184160372 22:42693979-42694001 GCAGACCAGCCGGTTCCTGCTGG - Exonic
1184184733 22:42857059-42857081 GCATCCCTGCGGGAACCGGCGGG - Intronic
953261038 3:41339247-41339269 GCAGTCCTGCTGCGAGCTGCTGG - Intronic
954578854 3:51692130-51692152 GCAGCCCTGCAGGACCCTGGGGG + Intronic
958625707 3:96619700-96619722 GCAGGCCGGCGGGCACCTGCTGG - Intergenic
962828223 3:139118383-139118405 GAGTTCCTGCAGGAACCTGCAGG + Intronic
967688773 3:192449065-192449087 TCAGTCCTTCCGATACCTGCGGG + Intronic
967894672 3:194386276-194386298 GCATTCCTGCCGGAGGCTCCAGG + Intergenic
980020645 4:127705762-127705784 GAAGTCTTTCCGGAACCTGAAGG + Exonic
980529202 4:134029215-134029237 GTCGTCCTCCCGGATCCTGCTGG - Intergenic
985213202 4:187617846-187617868 CCAGTTCTGCCTGAACCCGCCGG + Intergenic
994075674 5:95646859-95646881 GCAGCCCAGCCGGAAGCAGCTGG - Exonic
997984793 5:138493245-138493267 GCTGTCCTGCTGGAACATGGGGG - Intergenic
998349455 5:141491469-141491491 GCAGTCCAGCCCCAACCTGCAGG + Exonic
1001018516 5:168163038-168163060 CCAGTCCTGCCAGAACTTTCAGG + Intronic
1001425429 5:171619308-171619330 GAAGACCTGCAGGCACCTGCGGG - Intergenic
1002810331 6:622020-622042 GCAGTCCTGCTCTAACCGGCAGG + Intronic
1005674159 6:28137048-28137070 GCAGACCTGTGGGAACCTCCGGG + Intergenic
1007753315 6:44083074-44083096 TCTGTCCTGCTGGAAGCTGCTGG - Intergenic
1009625748 6:66137400-66137422 GCTGTTCTGTGGGAACCTGCTGG - Intergenic
1015141255 6:129935133-129935155 GCAGACCTGCTGGGACCTGCTGG + Intergenic
1017409793 6:154156196-154156218 GTGGTCCTGCCTCAACCTGCTGG - Intronic
1019291785 7:254108-254130 CCAGACCAGCCGGGACCTGCCGG + Intronic
1019563343 7:1668412-1668434 ACAGGCCTGGGGGAACCTGCTGG + Intergenic
1021841178 7:24723041-24723063 GCAGGGCTGCCGGAAACTGCAGG + Intronic
1022848358 7:34234801-34234823 GCAGGCCTGCTGGAATGTGCTGG + Intergenic
1024550998 7:50562285-50562307 GCAGCCGTGCAGGGACCTGCAGG + Intronic
1026229581 7:68471372-68471394 GCAGTCCTGCCAGAGGCTGCTGG - Intergenic
1026998275 7:74633761-74633783 GCAGTCCTCAGGGCACCTGCTGG - Intergenic
1030301810 7:107981632-107981654 GCATGACTGCTGGAACCTGCGGG + Intronic
1032566619 7:132953591-132953613 GCAGACCTGCTGGGACCTCCAGG - Intronic
1035620034 8:1029598-1029620 GCCATCCTGCCAGAACCTGTTGG - Intergenic
1040492155 8:47934141-47934163 GCACTGCTGCCAGAACATGCTGG + Intronic
1041389318 8:57335014-57335036 GCAGCCCTGCCAGATCCTGCAGG - Intergenic
1041716628 8:60938353-60938375 CCAGTCCTGCCTAAACCTGTAGG - Intergenic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1046031121 8:108785119-108785141 GCAGACTTTCCGGAAGCTGCTGG - Exonic
1049601019 8:143507711-143507733 CCAGGCCTGCAGGAGCCTGCAGG + Intronic
1056581735 9:87891978-87892000 GCAGGCCTGGCAGAAACTGCTGG - Intergenic
1059245109 9:112843146-112843168 ACAGTCCTGCCCAAACCTTCAGG - Intronic
1060944899 9:127564370-127564392 ACAGTGCTGCTTGAACCTGCTGG - Intronic
1061377950 9:130237143-130237165 GCCGTCCTGTCTGAACCTGCCGG + Exonic
1061506770 9:131036114-131036136 TCTGCCCTGCCGGCACCTGCGGG + Intronic
1062463376 9:136671093-136671115 GCAGTCCAGGGTGAACCTGCTGG + Intronic
1193786001 X:85760445-85760467 CCAGTCCTGCCCCAACCTGATGG - Intergenic
1194891517 X:99384885-99384907 GCAGCTCAGCCTGAACCTGCAGG - Intergenic