ID: 1104859903

View in Genome Browser
Species Human (GRCh38)
Location 12:131918446-131918468
Sequence GCCACGGTGTCTGCTGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104859890_1104859903 14 Left 1104859890 12:131918409-131918431 CCCTGGAGGTGTGGGAGTCTGTG 0: 1
1: 0
2: 1
3: 33
4: 366
Right 1104859903 12:131918446-131918468 GCCACGGTGTCTGCTGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 172
1104859891_1104859903 13 Left 1104859891 12:131918410-131918432 CCTGGAGGTGTGGGAGTCTGTGG 0: 1
1: 0
2: 3
3: 30
4: 348
Right 1104859903 12:131918446-131918468 GCCACGGTGTCTGCTGGTCCTGG 0: 1
1: 0
2: 1
3: 14
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104859903 Original CRISPR GCCACGGTGTCTGCTGGTCC TGG Intronic
900386797 1:2414357-2414379 GTCCCAGTGTCTGCTGTTCCTGG + Intergenic
900406378 1:2494893-2494915 GCCATTGCGTCTGCTGGCCCCGG - Exonic
900427815 1:2588448-2588470 GCCAAGGTGTGTGCGGGTCAAGG + Exonic
901761535 1:11474957-11474979 GCCTGGGTGTCTGCAGGCCCAGG + Intergenic
901921864 1:12542381-12542403 GCCAGGCTGTCTTCTGGGCCTGG - Intergenic
902383546 1:16063966-16063988 GCCAGGGTGTCAGCCGGGCCAGG - Intronic
903101473 1:21034831-21034853 GTCAGGGTGTCTGCTGAGCCTGG + Intronic
903575473 1:24337165-24337187 GCCCAGGTGTCTGAGGGTCCAGG - Intronic
904013485 1:27403616-27403638 TACACTGTGTCTGCTGGGCCCGG + Intergenic
916028858 1:160859245-160859267 GCCATGTTGCCTGCTGGTCCTGG - Intronic
917817601 1:178725838-178725860 GGCCCGGCTTCTGCTGGTCCTGG - Intronic
918142156 1:181728420-181728442 GCCCGGGTCTCTGCTGGTCTTGG - Intronic
921075724 1:211698901-211698923 GCCACGGGGCCTGTTGGCCCAGG + Intergenic
922798230 1:228352008-228352030 GCCACTGTGTCTGCAGGGCCGGG + Intronic
1062958839 10:1558046-1558068 GCCACGCTCACTGCTGGGCCTGG - Intronic
1063420992 10:5912471-5912493 CCCACGGTCTCTGCTTCTCCAGG - Intronic
1063454587 10:6174272-6174294 GTCACGATGTCTGCTTCTCCTGG - Intronic
1063880651 10:10528332-10528354 GCCAAGGTGTCTGCAGCTCCAGG - Intergenic
1067460853 10:46457213-46457235 CCCACAGTGTTTGCTGGACCTGG + Intergenic
1067626338 10:47927387-47927409 CCCACAGTGTTTGCTGGACCTGG - Intergenic
1070790799 10:79188239-79188261 GCCAGGGTGTGTGCAGGCCCAGG - Intronic
1072954354 10:99875678-99875700 TCCACAGTGTCTGCTGGTCGTGG - Exonic
1076306048 10:129466622-129466644 GACAGGGTCTCTGCTGGTCTGGG + Intergenic
1077135300 11:995052-995074 GCCACTGTGCCTGCTGGGCAAGG + Intronic
1077308658 11:1878871-1878893 GCTGCGGTGTCTGCAGGACCTGG + Intronic
1077461654 11:2713880-2713902 GCCATCGTGTCTGCAGGGCCAGG - Intronic
1078415650 11:11162632-11162654 GCCACTGTGTCTTGTGGTACAGG + Intergenic
1080601994 11:33829375-33829397 GCCCAGGTGTCCGCGGGTCCAGG - Intergenic
1080758312 11:35223584-35223606 GCCAGGGTGACTGCTGGTCTTGG - Intronic
1081708989 11:45205019-45205041 GCCAGTGTGTCTGGAGGTCCTGG + Intronic
1084559406 11:69894281-69894303 GCCACAGTGTCTGCTTGAGCCGG - Intergenic
1088583327 11:111335719-111335741 GCCAAGGTTTCTGCTGCACCTGG + Intergenic
1092164719 12:6335950-6335972 GGCACGGTGTTGGCTGGTGCGGG - Intronic
1092460422 12:8681249-8681271 GCCACTGTGTCTGGCGGTTCTGG + Intergenic
1094059546 12:26299213-26299235 GCCACAGTGTCTGCTAGGCAAGG - Intronic
1095038915 12:37421681-37421703 GCCGCGGTGGCTGCTGGATCCGG + Intergenic
1097038079 12:56137251-56137273 CCCACGGTGCCTGGTTGTCCTGG + Exonic
1103406293 12:120678002-120678024 CCCACCGTGTCTGCTGGTCCTGG - Intergenic
1103691606 12:122779536-122779558 GCCACTGCCGCTGCTGGTCCAGG + Intronic
1104448638 12:128852874-128852896 CCCGAGGTCTCTGCTGGTCCCGG + Intergenic
1104859903 12:131918446-131918468 GCCACGGTGTCTGCTGGTCCTGG + Intronic
1105029723 12:132874300-132874322 CCCACGCTGGGTGCTGGTCCTGG - Intronic
1105029804 12:132874565-132874587 CCCACGCTGGGTGCTGGTCCTGG - Intronic
1105029873 12:132874777-132874799 CCCACGCTGGGTGCTGGTCCTGG - Intronic
1105029939 12:132874989-132875011 TCCACGCTGGGTGCTGGTCCTGG - Intronic
1107254541 13:38407995-38408017 GCCACCGTGGCTGCTGATCCTGG + Intergenic
1108186840 13:47896297-47896319 GCCACGCTGGCTGCTGCTGCAGG - Intergenic
1113014466 13:105812639-105812661 ACCAGGGTGTCAGCTGGGCCAGG + Intergenic
1113681498 13:112248009-112248031 GCCACAGTCCCTGCTGGCCCAGG + Intergenic
1115933727 14:38528026-38528048 GCCCCAGTGGCTTCTGGTCCAGG - Intergenic
1119319059 14:73718767-73718789 GCCAGGGTGTCTGCGGGCGCTGG + Exonic
1121087796 14:91159936-91159958 GCCACGGTGCCTCCTGGCCAAGG + Intronic
1121336013 14:93077860-93077882 GCCTCGGTCCCTGCAGGTCCTGG - Intronic
1122172674 14:99889673-99889695 GACACGGAGCCTGCTGGGCCAGG + Intronic
1122761469 14:104031629-104031651 GCCAGGGTGTCTCCTTGTTCAGG + Intronic
1122877720 14:104676640-104676662 GCTACAGTGGCTGCAGGTCCAGG - Intergenic
1124200742 15:27676898-27676920 TCCTCAGTCTCTGCTGGTCCTGG - Intergenic
1124336127 15:28858436-28858458 ACAACGGTGTTGGCTGGTCCTGG + Intergenic
1129198496 15:73984859-73984881 TCCACGGTGTCTGCTGGGGGTGG + Exonic
1129678885 15:77646857-77646879 GCCCTGGTGTCTGCTGTCCCAGG - Intronic
1133128692 16:3663201-3663223 GCCACGGTGGCTTCTGGAGCTGG - Exonic
1133138329 16:3727872-3727894 GCCATGGTGACTGCGAGTCCGGG + Exonic
1136005203 16:27324636-27324658 GCCAGGCTGGCTGCTGTTCCTGG + Intronic
1136994139 16:35176663-35176685 GCCACGGCCACTGCTGGGCCAGG + Intergenic
1137377238 16:47962628-47962650 GACACTGTTGCTGCTGGTCCTGG + Intergenic
1137539700 16:49353802-49353824 GCCACGGTGGCTGCTGTTACGGG - Intergenic
1140929520 16:79614172-79614194 GCCATGGTGCCTGCGGGTCTGGG + Intergenic
1142265251 16:89061474-89061496 GGGACAGTGACTGCTGGTCCTGG - Intergenic
1142425495 16:90000258-90000280 GGCACCGTGTCAGCAGGTCCAGG - Intergenic
1143772420 17:9177218-9177240 GCCACTGTGTCTGCTGGGTGCGG - Intronic
1144412019 17:15010737-15010759 TCCACTGTGTCTGCTTCTCCAGG - Intergenic
1147933283 17:43996152-43996174 GCCACCTTTTCTGCTGGACCAGG + Intronic
1148960194 17:51386053-51386075 GCCAGGGTATCTGCAGGCCCAGG - Intergenic
1150216592 17:63474945-63474967 GCCCTGGTGTCAGCTGCTCCAGG + Intergenic
1150689290 17:67350635-67350657 GTCACAGTGTCTGCAGGTCATGG - Intronic
1152331334 17:79675031-79675053 GGCACAGTGTCTGCTGCTCAGGG - Intergenic
1153571500 18:6477805-6477827 GAAACTGTGTCTGCTGATCCTGG + Intergenic
1158411593 18:57210509-57210531 CCCTCGGCGCCTGCTGGTCCTGG - Intergenic
1160373073 18:78390547-78390569 GCCACGGTGGCTGCGGGCCTGGG + Intergenic
1160426124 18:78780378-78780400 GGCACGGTGTCGGGTGGCCCTGG + Intergenic
1160680899 19:411221-411243 TCCACCGTCTCTGCTGGGCCCGG + Intergenic
1160680926 19:411295-411317 TCCACCGTCTCTGCTGGGCCCGG + Intergenic
1160794919 19:940871-940893 GCCACTGTGGCTGCTGGCGCCGG + Intronic
1161529701 19:4780535-4780557 GGCACGGTGGCTGCTGGGCGCGG + Intergenic
1161686423 19:5704839-5704861 GCCATGGGGACTCCTGGTCCTGG + Intronic
1162706034 19:12555519-12555541 GCCCCGGTGTCTGCGGGGCAGGG - Intronic
1163807096 19:19405959-19405981 GTTACGGGGGCTGCTGGTCCGGG - Intronic
1163818484 19:19482548-19482570 CCCAGGTTGTCTGCAGGTCCTGG + Intronic
1164144592 19:22504293-22504315 GCCAGGGTTCCTGCTAGTCCTGG - Intronic
1164854707 19:31511980-31512002 GCCTGGGTGCCTGGTGGTCCAGG - Intergenic
1165112368 19:33509855-33509877 TCCATGGTGCCTGCTGTTCCAGG - Intronic
1165236492 19:34426310-34426332 GCCACTGTGACAGCTGGCCCTGG - Intergenic
1166382194 19:42360970-42360992 GCCATGGGGCCTGCTTGTCCGGG + Exonic
925337385 2:3108262-3108284 GCCAGGGTCTCTGCTGGGACAGG - Intergenic
926908917 2:17830904-17830926 GCCTCGGAGTCTGGTGCTCCTGG + Intergenic
928071604 2:28222885-28222907 GCCAGGGTGCCTCATGGTCCAGG - Intronic
928410328 2:31049477-31049499 GCCACTGTGCCTGCTGGGCCGGG + Intronic
929587112 2:43123588-43123610 GGCACAGCTTCTGCTGGTCCTGG - Intergenic
934766686 2:96883760-96883782 GCCCTGATGTCTGCTGGTGCTGG + Intronic
937811540 2:126204943-126204965 GCCACGGGGGCTGCTGATGCAGG + Intergenic
937985662 2:127637069-127637091 GCCACCTTGGCTGCTGGTCCTGG - Intronic
942306184 2:174609754-174609776 GCCACTGCTTCTGGTGGTCCTGG + Intronic
1169738642 20:8865838-8865860 TCCACGGTGTCTGCTGTGCCTGG - Intronic
1171448013 20:25218312-25218334 ACCACAGTGTCTGCAGCTCCTGG + Intronic
1171524520 20:25798679-25798701 GCCACGGCGGCGGCTGGTTCAGG + Intronic
1171552307 20:26057204-26057226 GCCACGGCGGCGGCTGGTTCAGG - Intergenic
1171837259 20:30168468-30168490 GCCACGGTGGTGGCTGGACCCGG + Intergenic
1172227795 20:33316838-33316860 ACCTCTGTGTCTGCAGGTCCTGG + Intergenic
1172418864 20:34797127-34797149 GCCATGCTGGCTGATGGTCCAGG - Intronic
1176164207 20:63664388-63664410 GCCCCGGTGGCTGCTGGGCCTGG + Intronic
1176370328 21:6058473-6058495 CCCACGGTGTCACCTGGGCCCGG - Intergenic
1179039659 21:37791122-37791144 CACACCGTGTCTGCTGGACCAGG + Intronic
1179753191 21:43480068-43480090 CCCACGGTGTCACCTGGGCCCGG + Intergenic
1180220560 21:46355645-46355667 GCCATGGTGTCGGCAGGTCCCGG + Intronic
1181407185 22:22693317-22693339 GCCACTGTGTCTGCAGGACAGGG - Intergenic
1182894662 22:33849237-33849259 GCCTGTGTGTCTGCTGGACCTGG - Intronic
1183266885 22:36833308-36833330 GCAACAGTGTCTGATGGGCCAGG + Intergenic
1185176571 22:49330733-49330755 CCCAGGGTGCCTGCTGGTCTCGG - Intergenic
1185339435 22:50284926-50284948 GCCACGATGTCAGGTGGGCCGGG - Intronic
949559553 3:5188593-5188615 GCCACTGTCCCTTCTGGTCCTGG - Intronic
950392460 3:12707380-12707402 GCCAGCGTCTCTGCTGGTCTAGG + Intergenic
952339081 3:32430304-32430326 GCCAGCGTGTCTGCTTGTCATGG + Intronic
954468706 3:50674273-50674295 GACACGGCATCTGCTGCTCCTGG - Intergenic
956792438 3:72690596-72690618 GGCACAGGGTCTGCGGGTCCAGG - Intergenic
957263347 3:77929295-77929317 GACACGGTTTCTACTGGGCCTGG + Intergenic
957263356 3:77929337-77929359 GACACGGTTTCTACTGGGCCTGG + Intergenic
962222119 3:133573221-133573243 GCCACGGTTTGTTCTGGGCCAGG + Intergenic
962407317 3:135111216-135111238 GACACGGAGGCTGCTTGTCCAGG - Intronic
966284623 3:178279173-178279195 GCCCAGTTGTCTGCTGATCCAGG + Intergenic
968589561 4:1450583-1450605 GCCACGGAGTCCCCTTGTCCCGG - Intergenic
968834049 4:2949775-2949797 ACCCCTGTGTCTGCTGATCCAGG - Intronic
969461173 4:7329826-7329848 GCCACGGTGTTTGGTGGTTAGGG + Intronic
969628606 4:8321983-8322005 GCCAGAGTGTCTGCTGAGCCCGG - Intergenic
973807450 4:54539839-54539861 GCCAGAGTGTCTGCAGGCCCAGG - Intergenic
982540553 4:156664959-156664981 GCCATGGTTTCTGCTGGACCTGG + Intergenic
984316591 4:178138355-178138377 GGAACAGTGTGTGCTGGTCCTGG + Intergenic
985508387 5:298326-298348 GCCACTGTCTCGGGTGGTCCTGG - Intronic
985739659 5:1607342-1607364 GCCACTGTCTCGGGTGGTCCTGG + Intergenic
985830066 5:2221603-2221625 GCCATGCTGTTTGCTGGTCTGGG + Intergenic
988479214 5:31615444-31615466 GCCTCGGTGTGTGATGTTCCTGG + Intergenic
990563242 5:57004377-57004399 GCCAAGGCCTCTGCTGGTCCTGG + Intergenic
992241405 5:74773431-74773453 GCCATGTTGCCTGCTGGTCTTGG - Intronic
992580454 5:78169926-78169948 GCCCCGGTGTGTGATGTTCCCGG + Intronic
994039077 5:95237249-95237271 GACATGGTGCCTGCTGGTTCTGG - Intronic
997912903 5:137893955-137893977 GCCATGGTGCCTGCTACTCCTGG - Intronic
999394001 5:151214993-151215015 CCCAGGGTGTCTGCTAGTTCTGG + Intronic
1000327491 5:160183515-160183537 GCCTCTGTATGTGCTGGTCCTGG - Intergenic
1001171901 5:169427285-169427307 GCCACTGAGAATGCTGGTCCAGG + Intergenic
1002494071 5:179599844-179599866 GCCAGGGTGGCTTCTGGACCTGG + Intronic
1006501311 6:34460828-34460850 GCCACAGTGTCTGTATGTCCTGG + Intergenic
1007777834 6:44233645-44233667 TCCACGGCGTGTGCTGGGCCCGG + Exonic
1008490334 6:52079797-52079819 GCCAGCGTGTCTGCTTGACCGGG - Intronic
1013597516 6:111673279-111673301 GCTGCGGTGACTGCTGCTCCCGG - Intronic
1013767829 6:113594983-113595005 GCCACAATGTCTGCTGGTAGAGG - Intergenic
1015376553 6:132516542-132516564 GCTACTGTGCCTGGTGGTCCTGG - Intergenic
1018807228 6:167270844-167270866 CCCACGGTGTCAGCCGGGCCAGG - Intergenic
1019032341 6:169024247-169024269 GCCACGCTGACTGCTGGACAGGG - Intergenic
1019214974 6:170437713-170437735 TCTTCAGTGTCTGCTGGTCCTGG - Intergenic
1021692897 7:23247731-23247753 GCCGCGGGGTCTCCTGGGCCGGG - Intronic
1026868865 7:73838806-73838828 GCCACAGCCTCTGCTGGGCCTGG + Intronic
1026937122 7:74263963-74263985 GTCACCGTGTCTGCAGGGCCCGG + Intergenic
1028911233 7:96209655-96209677 GCCACTGAATGTGCTGGTCCTGG + Intronic
1030311651 7:108074808-108074830 GCCAGGAAGTATGCTGGTCCTGG - Intronic
1030719648 7:112855427-112855449 ACCAAGGTGTCAGCTGGTCTGGG + Intronic
1033603589 7:142908604-142908626 GCCTCGGTGACTGCTGCTCTGGG + Exonic
1035316858 7:158001951-158001973 GCCAAGCTGTCTCCAGGTCCTGG + Intronic
1035482869 7:159201656-159201678 GCCACTGAGGCTGCTGGCCCTGG + Intergenic
1037548597 8:19948263-19948285 GCCACGGACTCTGCTACTCCGGG - Exonic
1038946022 8:32361225-32361247 GCCATGTTGTCTGCTTGTTCAGG - Intronic
1040952191 8:52948615-52948637 GCCGCTGTGTGTGCTGGGCCTGG - Intergenic
1042271964 8:66963329-66963351 GCAGCGGTTTCTGCAGGTCCTGG + Intergenic
1043504712 8:80890940-80890962 GCTGCTGTGGCTGCTGGTCCAGG + Intergenic
1043852521 8:85231084-85231106 GCCACGCTGTCTTCTGCTCTTGG - Intronic
1047512174 8:125523878-125523900 GCCACGATATCTGCAGCTCCTGG - Intergenic
1049797522 8:144503487-144503509 GCCACGGTGTGAGCTGTCCCAGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1049844338 8:144792728-144792750 GCCACGGGGTCTGGGGCTCCCGG + Intergenic
1053354360 9:37433669-37433691 GCCACTGATGCTGCTGGTCCAGG + Intronic
1054873007 9:70066587-70066609 GCCATGGTGTATGATGGTACAGG + Intronic
1061048279 9:128179249-128179271 GCCACGGGTCCTGCAGGTCCAGG - Exonic
1061482190 9:130902799-130902821 GCCCTTGTGGCTGCTGGTCCTGG + Exonic
1061974196 9:134060119-134060141 GCCTCTGTCTCTGCTGGGCCCGG - Intronic
1062077505 9:134598846-134598868 GCCAAGGTCTCTCCTTGTCCAGG - Intergenic
1062583914 9:137240548-137240570 GCCACGGAGTTTCCTGCTCCCGG - Intergenic
1062599432 9:137313292-137313314 GGCCAGGTGTCTGCTGGGCCTGG + Intronic
1187633228 X:21197779-21197801 GCCATGCTGTCTGCTACTCCTGG + Intergenic
1189446237 X:41084679-41084701 GCCGCGGTGCCTGGAGGTCCCGG - Intergenic
1200123074 X:153800387-153800409 GCCCCGGTGCCTGCTGCACCCGG - Intergenic