ID: 1104869305

View in Genome Browser
Species Human (GRCh38)
Location 12:131983215-131983237
Sequence TTTTGCACTCACATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104869305_1104869310 13 Left 1104869305 12:131983215-131983237 CCTAGCTCCATGTGAGTGCAAAA 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1104869310 12:131983251-131983273 CACCCACCAGACGTGCTCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104869305 Original CRISPR TTTTGCACTCACATGGAGCT AGG (reversed) Intronic
900820132 1:4880072-4880094 TTATGCACCATCATGGAGCTTGG + Intergenic
902885547 1:19402244-19402266 TATTGACCTCACAGGGAGCTGGG - Intronic
903579973 1:24363471-24363493 CTTTGCACTCAGACAGAGCTGGG + Intronic
905899639 1:41572951-41572973 TTCTCTACTCCCATGGAGCTAGG + Intronic
910557910 1:88557132-88557154 TTTGGCATTCAGCTGGAGCTGGG + Intergenic
913999593 1:143681757-143681779 TTTTGCAATAACATGGAGAGAGG - Intergenic
916451622 1:164926556-164926578 TCTTGCACTCACATGCAGGAAGG + Intergenic
918753055 1:188298017-188298039 TTGTGTTCTCACCTGGAGCTTGG + Intergenic
920226617 1:204443674-204443696 TTTTGCAGTGAGTTGGAGCTGGG - Intronic
920607144 1:207399680-207399702 TTGTGTGCTCACATGGAGCGGGG - Intergenic
921008031 1:211113237-211113259 TTTTGAAGTCACATAGACCTAGG - Intronic
921762274 1:218929861-218929883 ATTTGCACTCACATGTGCCTGGG + Intergenic
922007673 1:221548743-221548765 TTTTGGATTCAGATGGACCTGGG - Intergenic
922595153 1:226807941-226807963 TTTAGCACTCACTAGGAGTTGGG - Intergenic
1063552652 10:7047749-7047771 TTGTGCAGCCACATGGAACTGGG - Intergenic
1063740754 10:8816467-8816489 TTTTGGAATCACATGGTGCTGGG + Intergenic
1066402699 10:35090675-35090697 TTTCGCAATCACACGAAGCTTGG - Intergenic
1067158557 10:43803145-43803167 CTGTGCCCTCACATGGAGCAAGG + Intergenic
1068479218 10:57568303-57568325 TTTTGCAGTAACATGGATATAGG + Intergenic
1068664359 10:59657510-59657532 GTTTCAACTCACAGGGAGCTAGG - Intronic
1068894158 10:62181115-62181137 TTTTGCCCTCACTTGAATCTGGG - Intergenic
1069190026 10:65475975-65475997 TAAGGCACTCACATGGTGCTTGG + Intergenic
1070628276 10:78066707-78066729 TTCTCCACTCCCATGGAGATAGG - Intergenic
1073018176 10:100418824-100418846 TTAAGTACACACATGGAGCTGGG + Intergenic
1073106713 10:101036472-101036494 TTTTCCACCCACAGGCAGCTGGG + Exonic
1074086603 10:110212596-110212618 CTTTGCAGTCACATGGAGCAGGG + Intronic
1074552081 10:114453676-114453698 ATTTGAACTCAGGTGGAGCTGGG + Intronic
1076193131 10:128496938-128496960 TTGGGCATTCAGATGGAGCTGGG - Intergenic
1076687185 10:132203503-132203525 GTTTGCACACACATGCAGATGGG + Intronic
1076801970 10:132835123-132835145 TTCTCCCCCCACATGGAGCTTGG + Intronic
1079277700 11:19057043-19057065 CTATGCCCTCACATTGAGCTAGG - Intronic
1079324201 11:19477499-19477521 TTTTGCATTCAGACGGAACTGGG + Intronic
1080936922 11:36873485-36873507 TTTTGAAGTCACAGGGATCTAGG + Intergenic
1081639234 11:44741690-44741712 TTTTGGAGTCCCATGGATCTGGG + Intronic
1082201124 11:49368965-49368987 ATTTGTCCTCACAGGGAGCTGGG + Intergenic
1089370805 11:117955098-117955120 TTTTGAACTCAAATGGATCTGGG + Intergenic
1090017720 11:123100955-123100977 TTCTGCACTCACAGAGAGGTCGG - Intronic
1094416684 12:30223726-30223748 ATTTGCATTCACAGGAAGCTAGG + Intergenic
1099888657 12:88562703-88562725 TTTTCCACTTACATGGACCTAGG - Intronic
1100175720 12:92028769-92028791 TTTTGCACACACCTTGAGATTGG - Intronic
1102113953 12:110386891-110386913 TTTTGCACTCACCAGAAGCTTGG - Intronic
1104263350 12:127205903-127205925 TTTTGTTCTCTCCTGGAGCTGGG - Intergenic
1104433706 12:128738905-128738927 TTTTGAAGTCACATAGAGCAAGG + Intergenic
1104869305 12:131983215-131983237 TTTTGCACTCACATGGAGCTAGG - Intronic
1106212209 13:27660312-27660334 CTTTGCACTCTCATGGATGTAGG - Intronic
1107434475 13:40370192-40370214 TCTGTCACTCACCTGGAGCTGGG - Intergenic
1108154991 13:47575792-47575814 TTTTGCCTAGACATGGAGCTGGG - Intergenic
1109797336 13:67333486-67333508 TTTTGCAATTACATGAAGGTTGG + Intergenic
1114191419 14:20442098-20442120 CTTTTCACTCACCTTGAGCTTGG - Intergenic
1115888626 14:38002399-38002421 TATTGCATTCAGATGGATCTAGG + Intronic
1116019937 14:39447906-39447928 TATTACACTCACATGAAGCCAGG - Intergenic
1117397882 14:55328903-55328925 TTTTGTATTCCCATGGGGCTGGG + Intronic
1119811427 14:77523620-77523642 TCCTGCACTCACATGGAGCTGGG + Intronic
1120258377 14:82149782-82149804 TGTTGCATTCAGATGGATCTAGG + Intergenic
1121013867 14:90536604-90536626 GGTTGCTCACACATGGAGCTGGG - Exonic
1124125054 15:26931380-26931402 TTGTGCCCTCACATGGTGGTAGG + Intronic
1124808123 15:32906890-32906912 ACTTGCTCTCACATGGAGCATGG - Intronic
1127030671 15:54858539-54858561 TTTTTCACTGAAATGCAGCTAGG - Intergenic
1131455797 15:92581520-92581542 TTTTGCACTGATATGCCGCTAGG - Intergenic
1131798892 15:96049218-96049240 TTTTTCACTCCCAGGGAGTTGGG - Intergenic
1138350678 16:56344755-56344777 TTTTCCAGTCACCAGGAGCTCGG + Exonic
1139249221 16:65478820-65478842 TTTTCCATTCACAGAGAGCTTGG + Intergenic
1140552838 16:75886195-75886217 TATTGATCTCACATGGAGGTTGG - Intergenic
1144289076 17:13808102-13808124 CTTTGCACTCACCCAGAGCTGGG + Intergenic
1144813859 17:18019447-18019469 TATTCCACCCACATGGCGCTGGG - Intronic
1146831836 17:36076184-36076206 TCTTGCACTCACACAGGGCTAGG + Intergenic
1148642394 17:49197932-49197954 TTCTGCACTCAGATGGAGACTGG + Intergenic
1149249946 17:54756641-54756663 TTTTAGAATCACATAGAGCTAGG + Intergenic
1149521415 17:57321012-57321034 TGTACCACTCACCTGGAGCTAGG + Intronic
1150837871 17:68580756-68580778 TGTGGCACTCACATGGGGCCAGG + Intronic
1150892317 17:69167175-69167197 TGTTGAACTCACATGGTTCTGGG - Intronic
1153975879 18:10268101-10268123 TTTTCCACTTCCATGGATCTTGG - Intergenic
1155111387 18:22718139-22718161 TTTTGAAGTCACATAGACCTCGG - Intergenic
1156924721 18:42562149-42562171 TTTTACACTGACTTTGAGCTTGG + Intergenic
1157380889 18:47215697-47215719 TTCTGCAGTCACACGCAGCTAGG - Intronic
1158251437 18:55492214-55492236 CTTTGCACTTACTTGGACCTTGG - Intronic
1162569494 19:11463025-11463047 TTTTTCTCTCCCATGGGGCTAGG + Intronic
927102264 2:19797190-19797212 TTCTGCCCTGACCTGGAGCTGGG - Intergenic
930309262 2:49716956-49716978 TTTTGTAATCACATGGGACTTGG + Intergenic
935142710 2:100368095-100368117 TGTTGCACTAACCTGGAGCTTGG - Intergenic
937050295 2:118882974-118882996 TTTTGAACTCACTGGAAGCTGGG - Intergenic
938140237 2:128789466-128789488 CTTTGGACTCACGTGGAGCTGGG - Intergenic
940524024 2:154789140-154789162 TTTTGCAATAATATGCAGCTTGG - Intronic
940848322 2:158664119-158664141 TTTTGCACTGCCATGGAAGTGGG - Intronic
945593222 2:211760291-211760313 TTTGGCACACTCCTGGAGCTAGG - Intronic
946674424 2:222143541-222143563 TTTTGCAGCCAAATGAAGCTTGG - Intergenic
946684690 2:222256017-222256039 CTTTGCCCTCCCATGGTGCTGGG + Intronic
947886348 2:233575143-233575165 TTATGCACTCATATGGAGATGGG + Intergenic
1168762146 20:356547-356569 TTTGGCACTCACCAGGGGCTGGG + Intronic
1169715398 20:8611178-8611200 TTTTACATTCACAAAGAGCTTGG - Intronic
1170109128 20:12785809-12785831 TTTTACACTCACCTGGAGCAAGG + Intergenic
1173162230 20:40661598-40661620 TGTTGGATTCACATGGAACTGGG - Intergenic
1173664623 20:44755416-44755438 TGTTGCAATCCCATGGAGCGAGG + Intronic
1174919702 20:54688516-54688538 TCTTGCTCCCACATGGTGCTGGG - Intergenic
1176668557 21:9710514-9710536 TTGTGGACTCACATGGATCTTGG + Intergenic
1178385236 21:32143731-32143753 TATTGCAAACACATGGAGCGTGG + Intergenic
1178982954 21:37280593-37280615 TTTTGAACTCCCATAGTGCTGGG + Intergenic
1179027570 21:37692487-37692509 TGTTGCACTAAAATGGGGCTTGG - Intronic
1181024264 22:20118809-20118831 CTCTGTGCTCACATGGAGCTGGG + Intronic
1181318992 22:21990431-21990453 TATTCCACCCACATGGTGCTGGG + Intergenic
1181785707 22:25225178-25225200 CTTTGCAGTCAGATAGAGCTGGG + Intronic
1181893517 22:26085806-26085828 TTTTAAAGGCACATGGAGCTGGG - Intergenic
1182316592 22:29451597-29451619 TCTTGGATTCACATGAAGCTGGG - Intergenic
949293817 3:2496963-2496985 TTTTGCTCTCTTCTGGAGCTGGG - Intronic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
956209628 3:66789666-66789688 TGTTCAACTCACAGGGAGCTGGG - Intergenic
957331169 3:78766397-78766419 ATTTGTACTCACATAAAGCTTGG + Intronic
958456322 3:94336224-94336246 TTTTGCTCTCACATGATACTGGG - Intergenic
958462820 3:94420010-94420032 TTTTTCTTTCACATTGAGCTTGG - Intergenic
958853465 3:99356439-99356461 TTTTGCTCAAACATGGACCTTGG - Intergenic
959837938 3:110942944-110942966 TGTTGCACTGACTTGGAGATGGG - Intergenic
960503837 3:118469491-118469513 TTTTGCACTTGCATGTAGCTTGG - Intergenic
962942430 3:140137886-140137908 GTTTGGAATCACATGGACCTGGG - Intronic
966284361 3:178276070-178276092 TTTTCCACCCACATGGAGTTTGG - Intergenic
967958045 3:194893410-194893432 TTTTGCTTTCTCTTGGAGCTGGG + Intergenic
969087484 4:4667355-4667377 TTTTGAACTCATTTTGAGCTGGG + Intergenic
969178606 4:5420155-5420177 TTTTGGAGTCACATTGACCTGGG - Intronic
969202540 4:5617427-5617449 TTTTGCACACATCTGGTGCTTGG + Intronic
979693331 4:123583914-123583936 ATTTGCTTTCACATGGAGCTGGG + Intergenic
984389690 4:179112930-179112952 TTTTGCAATCACACTTAGCTAGG + Intergenic
984514242 4:180718998-180719020 TTTTGCAGTGATATTGAGCTGGG - Intergenic
985198299 4:187456901-187456923 ATCTACACTCACATGGATCTTGG + Intergenic
985406225 4:189641013-189641035 TTGTGGACTCACATGGATCTTGG - Intergenic
985485013 5:143546-143568 TTTGCCACACACATGCAGCTGGG - Intronic
989158856 5:38370921-38370943 TTGAGCGCTGACATGGAGCTGGG + Intronic
990517530 5:56544285-56544307 TCCTGCACTAACATGGAGTTGGG + Intronic
990703500 5:58500734-58500756 TTGTGTCCTCACATGGTGCTGGG - Intergenic
994163271 5:96580940-96580962 TTGTGTCCTCACATGGAGCAAGG - Intronic
995628769 5:114110042-114110064 TTATGCTCTCACATGGAGGAAGG - Intergenic
997001831 5:129770867-129770889 TTTTGTACTCACTTGGAGACTGG - Intergenic
997807964 5:136938470-136938492 TTATGCACTTACATGGTGTTTGG - Intergenic
997906774 5:137824916-137824938 TTTTGCAATCAGATAGATCTTGG + Intergenic
997956957 5:138286250-138286272 TTTTGCAAACACAGGGAGATTGG - Intronic
1000759734 5:165207624-165207646 TTTTTCAGTCAAATGGAGTTTGG + Intergenic
1000765277 5:165281691-165281713 TTTTGCACAGGCATGGAGGTGGG + Intergenic
1000968198 5:167684500-167684522 TTGTGCTCTCAGATAGAGCTTGG + Intronic
1001081271 5:168669378-168669400 TGCTGCACTCCCATGGCGCTGGG - Intronic
1001437050 5:171707614-171707636 TTGGGCACTCACATTGGGCTTGG - Intergenic
1002914566 6:1518667-1518689 TTCTGTAGTCACCTGGAGCTGGG + Intergenic
1004130628 6:12915827-12915849 CTTTGCTCTCACATGGACTTTGG + Intronic
1004573627 6:16871656-16871678 TTTAGCAATGACATGGAGGTAGG + Intergenic
1005205787 6:23402843-23402865 ATTTCCACTCACATGGAATTGGG + Intergenic
1007522230 6:42459779-42459801 GGTTGCACACCCATGGAGCTCGG - Intergenic
1011876602 6:91970355-91970377 TTTTGCACTCTAAAGGAACTCGG - Intergenic
1012021397 6:93925530-93925552 CTTTGCACTCACATGCACCAAGG - Intergenic
1012658106 6:101851832-101851854 TTTTATATTCACATGGAGTTTGG + Intronic
1013229040 6:108144734-108144756 TTTTAAACACAAATGGAGCTGGG + Intronic
1013890454 6:115020742-115020764 TTTTGGACTTGCATGGGGCTGGG - Intergenic
1014480394 6:121928697-121928719 TTTTGGACTCCCAAGGTGCTGGG - Intergenic
1015133708 6:129843563-129843585 TTTTGAAATCAAATGGAGCCAGG + Exonic
1015330566 6:131973972-131973994 TTTTGCAGCCTCATGGTGCTGGG + Intergenic
1015545460 6:134356895-134356917 CTTTTCACAGACATGGAGCTGGG + Intergenic
1016799466 6:148154172-148154194 TTTTGGAGTCAGATGGAGCTGGG + Intergenic
1019066817 6:169309235-169309257 TTTTGCAGCAACATGGAACTAGG + Intergenic
1021582859 7:22175435-22175457 AGTTGCTCTCACAAGGAGCTGGG + Intronic
1021787409 7:24165340-24165362 TTTTGCTCCCACTTGCAGCTCGG + Intergenic
1022399539 7:30024071-30024093 TATTGCACTGAAAGGGAGCTAGG - Intronic
1022625303 7:32030029-32030051 TTTTTCACTCACCCGTAGCTTGG - Intronic
1023922006 7:44637071-44637093 TTTTTCACTCACCTGCAGCCTGG + Intronic
1031070900 7:117160464-117160486 TTTTGCAATCAGATAGATCTGGG - Intronic
1033139169 7:138809489-138809511 TTTTACACTCACATGGGCCCTGG - Intronic
1041017271 8:53603234-53603256 TTTTGCTCTCACATTGACCATGG - Intergenic
1041219745 8:55637384-55637406 TTCTGCTCTAACCTGGAGCTGGG - Intergenic
1041439167 8:57875238-57875260 GTTTTCACTCACATGGAGAAAGG - Intergenic
1041763974 8:61398025-61398047 TTTTGCACAAAAAAGGAGCTTGG + Intronic
1045755886 8:105541369-105541391 TTTTGAAGTCAGATGGAGATGGG - Intronic
1046526262 8:115385580-115385602 TTTGTCACTCTCCTGGAGCTAGG - Intergenic
1048549335 8:135419527-135419549 CTTTGCAATCAGCTGGAGCTAGG + Intergenic
1049233854 8:141498253-141498275 TTTGGAACTCACACAGAGCTAGG + Intergenic
1051572562 9:18576933-18576955 TTTTGAACTCAGACAGAGCTGGG - Intronic
1055717025 9:79128923-79128945 TTGTGAACACACATGGAGATGGG - Intergenic
1057510909 9:95678804-95678826 TTCTGCACTCTCAGGGACCTGGG - Intergenic
1058596824 9:106623822-106623844 TATTGTGCTCACATGGAGATTGG - Intergenic
1058914908 9:109556372-109556394 TTTTGAAATGACAAGGAGCTGGG - Intergenic
1059763928 9:117365513-117365535 TTTCCCTCTCACATGGAGTTTGG - Intronic
1061699801 9:132407287-132407309 TTTTGCACTCACTTCCAGCCTGG - Intergenic
1203657309 Un_KI270753v1:10427-10449 TTGTGGACTCACATGGATCTTGG - Intergenic
1186314285 X:8351823-8351845 TATTGCATTCACATGTACCTTGG + Intergenic
1187221309 X:17328745-17328767 GTTTGCAATAACATGAAGCTTGG - Intergenic
1188499479 X:30809874-30809896 TTTTTTGCTGACATGGAGCTGGG - Intergenic
1189298415 X:39935375-39935397 TTTTGGAGTCAGATGGAACTGGG - Intergenic
1189553610 X:42118784-42118806 CTTTGCAATCACACAGAGCTGGG + Intergenic
1193337320 X:80306356-80306378 TTTTGAACTCACATGGGGCCTGG - Intergenic
1194358447 X:92917942-92917964 TTTTGGACTCACCTGGGGCCTGG - Intergenic
1195602141 X:106761796-106761818 TTATTCTCTCACTTGGAGCTTGG - Intronic
1197689728 X:129485307-129485329 TTTTGGACTTGCATGGGGCTTGG + Intronic
1197987071 X:132278233-132278255 TTCTGGACTCACCTGGGGCTCGG - Intergenic