ID: 1104870777

View in Genome Browser
Species Human (GRCh38)
Location 12:131994007-131994029
Sequence CCAAGTGATCAGAAGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 326}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104870767_1104870777 26 Left 1104870767 12:131993958-131993980 CCACCCGAGGTCGTCTTTACTTT 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 326
1104870768_1104870777 23 Left 1104870768 12:131993961-131993983 CCCGAGGTCGTCTTTACTTTTCT 0: 1
1: 0
2: 1
3: 15
4: 224
Right 1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 326
1104870771_1104870777 -3 Left 1104870771 12:131993987-131994009 CCAAAATTCCACCCTGGAAACCA 0: 1
1: 0
2: 4
3: 27
4: 216
Right 1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 326
1104870769_1104870777 22 Left 1104870769 12:131993962-131993984 CCGAGGTCGTCTTTACTTTTCTT 0: 1
1: 0
2: 0
3: 34
4: 351
Right 1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG 0: 1
1: 0
2: 3
3: 28
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104870777 Original CRISPR CCAAGTGATCAGAAGGCAGA AGG Intronic
900936108 1:5767130-5767152 ACAAAAGATCACAAGGCAGAAGG + Intergenic
904636387 1:31884764-31884786 CCAGCTGATCACAAGGCTGAAGG + Intergenic
905383641 1:37583086-37583108 CCCAGTGATCAGAATTCAAAAGG + Intronic
906496085 1:46304912-46304934 CCAAGTGACCAGAGAACAGACGG - Intronic
906840557 1:49134203-49134225 ACAAAAGATCACAAGGCAGAAGG + Intronic
908607257 1:65812154-65812176 CCAAATCAGCAGAAGGCTGAGGG - Intronic
908615032 1:65910754-65910776 GCAAAAGATCAGAAGGCAGGAGG - Intronic
909412768 1:75374091-75374113 GCAAGTGACCTGAATGCAGAAGG + Intronic
909529026 1:76660384-76660406 TCAAGTTATCAGAAAGCATAAGG + Intergenic
909749294 1:79138513-79138535 ACAAAAGATCACAAGGCAGAAGG - Intergenic
910502031 1:87903335-87903357 CCAGGTGAACAGAAGGGAGAGGG + Intergenic
911586112 1:99692791-99692813 GAAGGTGAACAGAAGGCAGAAGG - Intronic
912097368 1:106161782-106161804 ACAAAAGATCACAAGGCAGAAGG - Intergenic
912304861 1:108557050-108557072 CCAAGAGATCAGAAAGTAGGAGG + Intergenic
913355975 1:117922728-117922750 ACAAAAGATCACAAGGCAGAAGG + Intronic
913468078 1:119163628-119163650 CCAAGTGAAGAGAAGACACAGGG + Intergenic
914390271 1:147215001-147215023 CAGGATGATCAGAAGGCAGAAGG + Intronic
914826009 1:151138398-151138420 CGAAGTTATCTGAGGGCAGAGGG + Exonic
915075422 1:153304576-153304598 GAAAGTGACCAGAAGGCAGCAGG - Intronic
920376850 1:205513395-205513417 CCAAGTGATAAGATGGGACAAGG - Intronic
922198517 1:223381244-223381266 CAAAGTAACCAGAAGCCAGATGG + Intergenic
922419665 1:225451061-225451083 CTGAGTGAGCAGAAGGAAGAGGG - Intergenic
922707763 1:227798561-227798583 CCACATGATCAGCAGGCACACGG - Intergenic
923971890 1:239212848-239212870 CCAATTGATCACAAAGCATATGG - Intergenic
923985675 1:239379041-239379063 ACAAGTGAATAGATGGCAGAAGG - Intergenic
1063612052 10:7570942-7570964 CCATGTGCACAGAAGGCAGAGGG - Intronic
1064288271 10:14011524-14011546 CCAGGAGATTGGAAGGCAGATGG - Intronic
1065205378 10:23352410-23352432 CCAAGTGCTCAGGAAGGAGAAGG + Intergenic
1068071776 10:52205219-52205241 ACAAAAGATCACAAGGCAGAAGG - Intronic
1068577888 10:58705272-58705294 CCATGTGTTCTGAAGGCAAAGGG + Intronic
1068899549 10:62251484-62251506 CCAAGTGATTAGAAGTCAGGTGG - Intronic
1069468591 10:68664887-68664909 CCAGTTGCTCAGAAGGCTGAGGG - Intronic
1069760784 10:70809595-70809617 CCAAGTAACCACAAGACAGAGGG + Intergenic
1070854910 10:79599943-79599965 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1070891316 10:79943892-79943914 CCAAGTCAGCAGCAGGAAGATGG + Intronic
1071198056 10:83184607-83184629 CCAAGTGATCAGGACAGAGATGG + Intergenic
1071488993 10:86123251-86123273 CCTAGGGAACAGAGGGCAGAGGG + Intronic
1072746984 10:97947320-97947342 CCAAGCTTTCAGAGGGCAGAGGG + Intronic
1073003253 10:100301182-100301204 ACAAAAGATCACAAGGCAGAAGG + Intronic
1074046983 10:109848275-109848297 CCAAGTGATGTCAAGTCAGAGGG + Intergenic
1075030560 10:119021915-119021937 CTTAGTGACCAGAAGGCAGGTGG - Intergenic
1076108510 10:127844006-127844028 ACAAGTCATGAGAAGGGAGATGG + Intergenic
1076328404 10:129646150-129646172 CCCAGTGTTCAGATGGCGGAAGG + Intronic
1076478463 10:130768481-130768503 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1076895113 10:133307375-133307397 CCAAGTGATTAAAACACAGAGGG + Intronic
1078264087 11:9740174-9740196 CCAACAGATCAGACAGCAGATGG + Exonic
1079120453 11:17680394-17680416 CCAGGTGAGCAGAAGCCATATGG - Intergenic
1079247765 11:18765611-18765633 CCAAGTGATAACAGGTCAGAAGG + Intronic
1081808918 11:45904574-45904596 CCAAGGGAGGAGAAGGGAGAGGG - Intronic
1083603190 11:63961523-63961545 CTAGGGGCTCAGAAGGCAGAGGG + Intergenic
1084010608 11:66346471-66346493 CCAGGTGCTCATAAGGGAGAGGG - Exonic
1084150073 11:67284008-67284030 ACAGGTGATAAGAAGGGAGAGGG - Intronic
1086135359 11:83438819-83438841 CCAAGGCTACAGAAGGCAGAGGG - Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086575652 11:88336793-88336815 CCATGTTATCTGAAGGCATATGG + Intronic
1087982706 11:104635931-104635953 CCATGTGATCAGAGGAAAGATGG - Intergenic
1088020783 11:105116019-105116041 CAGAGTGATCAGACAGCAGAAGG + Intergenic
1089281019 11:117374553-117374575 CCATGGGCTTAGAAGGCAGATGG + Intronic
1090260175 11:125313804-125313826 CCAAGTGCTCAGTAGCCACATGG + Intronic
1090386494 11:126360221-126360243 CCAAATGATCAGAACCCAGTGGG - Intronic
1090436309 11:126689525-126689547 CCAGGTGACAAGAAGGCAGCTGG - Intronic
1091084651 11:132709609-132709631 CCAAGTGATCCGAAACCAGGGGG - Intronic
1091239523 11:134043184-134043206 ACAGATGCTCAGAAGGCAGAAGG - Intergenic
1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG + Intronic
1094324709 12:29224598-29224620 CAAAGTACTCAGAAGGCCGATGG + Intronic
1094377085 12:29801779-29801801 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1094385044 12:29885034-29885056 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1094626785 12:32132031-32132053 CCAAGTGGTCAGAAGGAGCAAGG + Intronic
1096105744 12:48996320-48996342 CAGAGTGATCAGATGACAGAGGG - Exonic
1096339322 12:50784046-50784068 CCAACTACTCAGGAGGCAGAAGG + Intronic
1096625870 12:52895677-52895699 ACATGTGAGCAGAAGGCAGAAGG + Intergenic
1097246374 12:57609912-57609934 CCAGGTCCTCAGGAGGCAGAGGG - Intergenic
1097545380 12:60993718-60993740 ACAAGAAATCAGAAGTCAGAGGG + Intergenic
1100109501 12:91221823-91221845 ACCACTGAACAGAAGGCAGAAGG - Intergenic
1100791777 12:98138083-98138105 CCAAGTGCACAGAAGGAGGAAGG - Intergenic
1100909092 12:99338054-99338076 CCAAGTGTTCTTAAGTCAGAAGG + Intronic
1102027024 12:109719476-109719498 TCAAGTGATAAGAAATCAGATGG + Intronic
1102034939 12:109765726-109765748 CCCACTGATCAGAAGGCTGCTGG - Intronic
1102436298 12:112926617-112926639 ACAAAAGATCACAAGGCAGAAGG + Intronic
1102558218 12:113742813-113742835 CCAGGGCACCAGAAGGCAGAAGG - Intergenic
1102941539 12:116946827-116946849 ACAAGGGGTCAGAAAGCAGAGGG + Intronic
1104078076 12:125407960-125407982 CCAAGTAATCGGCATGCAGAAGG + Intronic
1104870777 12:131994007-131994029 CCAAGTGATCAGAAGGCAGAAGG + Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284639 13:18994173-18994195 CCAAAAGGCCAGAAGGCAGAAGG + Intergenic
1105284900 13:18995748-18995770 CCAGATATTCAGAAGGCAGAAGG + Intergenic
1105284940 13:18996008-18996030 CCAGATGAGCGGAAGGCAGAAGG + Intergenic
1105637779 13:22232060-22232082 CCATCTGATCAAAAAGCAGATGG - Intergenic
1108281699 13:48868143-48868165 CCAACTGAACACAAGGCAAATGG - Intergenic
1109803919 13:67412619-67412641 CCAAGTGATCAGAAATAGGATGG + Intergenic
1110242247 13:73282298-73282320 GCCAGTGAGAAGAAGGCAGAAGG - Intergenic
1110843196 13:80166086-80166108 CAAAGTGAGCAGATGGCTGAAGG - Intergenic
1112375254 13:98833810-98833832 CTATGTGATGAGAAGGCAGCAGG - Intronic
1112816760 13:103281854-103281876 CCATGTGATCACTAGGGAGAAGG - Intergenic
1112844017 13:103615737-103615759 GCAACTGATCAGAAGGTAGCTGG + Intergenic
1115022218 14:28696120-28696142 CCAAATGATCACATGGGAGAAGG - Intergenic
1115964910 14:38877203-38877225 CCAGCTACTCAGAAGGCAGAAGG + Intergenic
1116030517 14:39565575-39565597 CCTAGAAAACAGAAGGCAGATGG - Intergenic
1116464201 14:45213015-45213037 CCAAGGAAACATAAGGCAGAAGG - Intronic
1117099141 14:52327906-52327928 CTAAGTGATCACAAGACAGCAGG - Exonic
1120191809 14:81446466-81446488 CCCATTGATCAGAAGTGAGAGGG - Intergenic
1120295413 14:82634033-82634055 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1120672816 14:87383970-87383992 CCAGGTGATAAGAAGCTAGAAGG - Intergenic
1120883644 14:89434612-89434634 CCAAGGGTTCAGATGGGAGATGG - Intronic
1121225219 14:92316821-92316843 CCAAGTGAGCAGAGGGCAGTGGG + Intergenic
1121262675 14:92577988-92578010 CCAACACTTCAGAAGGCAGAGGG + Intronic
1121732684 14:96197527-96197549 ACAAGTGATCAGAGGACAGGAGG + Intergenic
1122319749 14:100846964-100846986 ACAAGTGATCAAAAGGGAGAAGG + Intergenic
1124955348 15:34356586-34356608 CCCAGTGATCTGTGGGCAGAAGG + Exonic
1125456892 15:39869097-39869119 CCACTTGAACAGAATGCAGAGGG - Intronic
1125506881 15:40272315-40272337 CGAAGTGGTCAGAGGGCTGAAGG - Exonic
1125766737 15:42141403-42141425 CGAGGAGACCAGAAGGCAGAAGG + Exonic
1126192778 15:45896043-45896065 CCAATTGATAAGCAGGCAAAGGG - Intergenic
1128348256 15:66869084-66869106 GCAGGAGAACAGAAGGCAGAGGG - Intergenic
1128370104 15:67034083-67034105 CCAAGAGATCAGAGGGCTCAGGG - Intergenic
1128590190 15:68888556-68888578 CCGAGTGTTCAGAAGAGAGACGG - Intronic
1129155292 15:73713792-73713814 CAAAGAGGTGAGAAGGCAGAGGG - Exonic
1129170512 15:73804614-73804636 CCAAGCAATTAGAAGGCAGAGGG - Intergenic
1129698004 15:77751614-77751636 CCAAGTGATCAGAGGAGGGAGGG - Intronic
1130011152 15:80153701-80153723 CCTACTGATCAGAAGAAAGAGGG + Intronic
1130881731 15:88061386-88061408 CCCAGTGGTCAGAAGGGACACGG + Intronic
1131507661 15:93031436-93031458 CCAGGTGCTCAGCGGGCAGATGG - Intergenic
1133660285 16:7909803-7909825 CAAAGTGATGAGAGAGCAGAGGG + Intergenic
1135537096 16:23302655-23302677 CCCAGGGTGCAGAAGGCAGACGG + Intronic
1137484740 16:48881845-48881867 CCAAGGTATCAGAAGGCTGGTGG - Intergenic
1139135184 16:64194750-64194772 CCCAGTGATCAGGAGGCTAAAGG - Intergenic
1139469220 16:67169537-67169559 CTAACTGAGCAGAAGGCAGGCGG + Intronic
1141088230 16:81111837-81111859 CCAACTGGTCAGAAGGCACAGGG - Intergenic
1142187899 16:88703158-88703180 CCCAGTGACCAGAAAGCAGACGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143322882 17:6079509-6079531 CCCAGAGAAGAGAAGGCAGAAGG - Intronic
1143936071 17:10485224-10485246 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1145868821 17:28257270-28257292 CCAAGTGGTCAGATGGTTGAAGG - Intergenic
1145982239 17:29019911-29019933 CCAGGTGACCAGAAGGGAGAGGG + Intronic
1147371093 17:39993551-39993573 CCAAGTGATGGGAAGGAGGATGG - Intronic
1147780503 17:42937800-42937822 GCAAGTCATCAGAAGCCACAAGG + Intergenic
1147905048 17:43817128-43817150 CCAGGTGACCAGAACACAGATGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151258453 17:72898080-72898102 CCAAGTGAACTGAATGCAGCAGG + Intronic
1152257407 17:79248198-79248220 CCAAGTGATGAAAAGGCTGGTGG + Intronic
1152506748 17:80754378-80754400 CGAACAGATCAGAAGGAAGAAGG - Intronic
1154014617 18:10605232-10605254 CCCTGTGCTCACAAGGCAGAGGG - Intergenic
1156309340 18:35908151-35908173 CAAAGAGATCAGCAGGCAGCGGG + Intergenic
1157560795 18:48644542-48644564 CCAAGTGAGCTGGAGCCAGAAGG - Intronic
1157943977 18:51958254-51958276 TCAAGTGAAAAGAAGGCAAAAGG + Intergenic
1158509688 18:58079598-58079620 CCAAGTGATCGGAGCCCAGAGGG - Intronic
1158769709 18:60500069-60500091 GCAATTGATCTGAAGGCAAAGGG - Intergenic
1160483208 18:79261907-79261929 CCAAGTGTTCAGCAGGCAGAAGG - Intronic
1161935424 19:7368893-7368915 CCTGGTGATCAAAAGGCAGAGGG + Intronic
1163755078 19:19101748-19101770 ACATGTGATCAGAGGTCAGAGGG - Intronic
1165300565 19:34965827-34965849 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1166781360 19:45345194-45345216 CCAGGTGAGCTGAGGGCAGATGG + Intronic
1167480314 19:49726454-49726476 CCAAGTGCTAAGCAGGCAGTTGG + Intergenic
925901457 2:8512076-8512098 CCAAGTGGTAAGAAGCCACAGGG - Intergenic
926371029 2:12178854-12178876 CCACATGATCAGTAAGCAGAAGG + Intergenic
928681643 2:33708741-33708763 CCGAGTGATCAGATGCAAGAGGG + Intergenic
928726457 2:34179416-34179438 CCAAGTGAATAGAAAGGAGAGGG + Intergenic
929692605 2:44087130-44087152 CCCAGGAATCAGAAGCCAGACGG + Intergenic
929828023 2:45325159-45325181 TCAACTGAACAGAAGGCTGAGGG - Intergenic
930191341 2:48463244-48463266 CCCAGTGATCAGGAGGCAGAGGG + Intronic
930657673 2:54022494-54022516 CCAACTACTCAGAAGGCTGAGGG - Intronic
930741306 2:54835414-54835436 GCAAGTGATGAGGATGCAGAAGG + Intronic
931275760 2:60742482-60742504 CCAAGTGATTAGAAGAAAGCTGG + Intergenic
932577815 2:72972439-72972461 CCAAGATCTCAGATGGCAGAGGG - Intronic
934611294 2:95738727-95738749 CCAAAGGATCAGGAAGCAGAAGG - Intergenic
934930007 2:98414543-98414565 ACAAAAGATCACAAGGCAGAAGG - Intergenic
934932231 2:98436005-98436027 ACAAAAGATCACAAGGCAGAAGG - Intergenic
935018345 2:99205857-99205879 ACAAAAGATCACAAGGCAGAAGG - Intronic
935950191 2:108321856-108321878 CCAGGTGAAGAGAAGGAAGAGGG + Intergenic
936688462 2:114857356-114857378 CCATCTGATGAGAAGGCAGGAGG - Intronic
936876337 2:117194281-117194303 ACAAGTGCTTAGAAGACAGAGGG + Intergenic
937722255 2:125115112-125115134 CCTAGAGACCAGAAGGCAGTTGG + Intergenic
937863172 2:126729419-126729441 CAAAGAGCTCAGCAGGCAGAGGG + Intergenic
938366339 2:130737548-130737570 CAAAGTGATCAGGAGCCAGCTGG + Intergenic
938752818 2:134350632-134350654 CCAAGTAAACAGAAAGCAGCAGG - Intronic
940865634 2:158815158-158815180 CCCAGTGAAGAGAAGGCTGAGGG - Intronic
940886991 2:158998849-158998871 CCAAGAGATCAGAGGGGAGGGGG - Intronic
941790407 2:169546625-169546647 CCAAGTGAGGAGAAGGGAGCAGG + Exonic
941878334 2:170457867-170457889 CCAACTGCTCAGGAGGCTGAGGG - Intronic
941885915 2:170527211-170527233 TCCAGTGAGAAGAAGGCAGAGGG + Intronic
942093251 2:172514291-172514313 CCAAGCGAGCAGTAAGCAGAAGG + Intergenic
943065898 2:183085796-183085818 CATTGTAATCAGAAGGCAGAGGG + Intronic
944151296 2:196561440-196561462 ACAAAAGATCACAAGGCAGAAGG - Intronic
944938011 2:204589889-204589911 CCCAGTGAGCAGATGGGAGATGG + Intronic
946295391 2:218779786-218779808 TCAAATGATCAAAAAGCAGAAGG - Intergenic
947276464 2:228397361-228397383 ACAAAAGATCACAAGGCAGAAGG + Intergenic
947413879 2:229872447-229872469 CCAGCTGCTCAGAAGGCTGAAGG + Intronic
948512528 2:238478483-238478505 CCAAGAGCTCAGAGAGCAGAAGG - Intergenic
1171370854 20:24661277-24661299 GCAAGTGAGCAGAAGAAAGAAGG + Intronic
1171955647 20:31461065-31461087 CCAAATGTTCAGCAGGCAAATGG - Intergenic
1172036969 20:32018040-32018062 CCAGGTGAGCAGCAGGCAGCGGG - Exonic
1172394260 20:34588482-34588504 CCAAGAGCTGAGAAGGAAGAAGG + Exonic
1172470396 20:35189522-35189544 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1173703897 20:45096207-45096229 CCAAGTGATGAGAAAGCTGCTGG + Intronic
1174684349 20:52439169-52439191 CAAAGGGAACAGAAGGCAAAAGG - Intergenic
1175714279 20:61245359-61245381 CCAAGTGATCAGACACCACATGG - Intergenic
1175772006 20:61629875-61629897 CCAGCTGAACAGGAGGCAGAGGG + Intronic
1177326155 21:19591827-19591849 CCACCTGCTCAGGAGGCAGAGGG - Intergenic
1177500365 21:21947200-21947222 CCACCTGCTCAGAAGGCTGAGGG + Intergenic
1177765931 21:25457464-25457486 CCAAGAGTTCACAAGGGAGATGG - Intergenic
1177807690 21:25890168-25890190 CCAAGAGAACAGCAGGCAGCAGG - Intronic
1180017743 21:45098262-45098284 CCAAGGGATCTGGAGACAGATGG - Intronic
1182870224 22:33639908-33639930 CCAAATGATAAGAGGGCAAAGGG + Intronic
1183807754 22:40226440-40226462 ACAAGTGATCTGACGGCAGGTGG - Intronic
1184152286 22:42646135-42646157 CCAAGTAAACAGAAGGCAGGTGG + Intronic
1184495768 22:44840438-44840460 TCTAGTGAGCAGAAGGGAGAGGG - Intronic
1184653211 22:45928644-45928666 ACAAGTGATGGAAAGGCAGAAGG - Intronic
949210894 3:1499769-1499791 CCAAGTCATCCCATGGCAGAAGG + Intergenic
952609809 3:35194740-35194762 CCAAGGAATCTGAAGGTAGAAGG + Intergenic
952655266 3:35778368-35778390 GCAAGAGATCAAAGGGCAGAGGG + Intronic
955294969 3:57726709-57726731 CCAAGTGATGATAATGCAGCTGG + Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957177247 3:76827328-76827350 GTAAGTGTTCAGAAGTCAGAAGG - Intronic
957756281 3:84492283-84492305 ACAAAAGATCACAAGGCAGAAGG - Intergenic
958844514 3:99249942-99249964 CCAGGTGGTCTGAAGGGAGAGGG + Intergenic
959370983 3:105525521-105525543 TCAAGTTATCAGAAAGCAGAGGG - Intronic
959696457 3:109253883-109253905 CCAAATGTTCAGAAGGCACAGGG + Intergenic
959918617 3:111846485-111846507 TCAAGTAACCAGAAGGCTGAGGG + Intronic
960160045 3:114340380-114340402 CCAAGAGTTCAAAAGGCATATGG - Intronic
962368205 3:134799701-134799723 ACAAGTCAATAGAAGGCAGAAGG - Intronic
962621406 3:137183612-137183634 GCATGTGATCAGTAGGCATATGG - Intergenic
963056187 3:141188209-141188231 GCAAGTAATAAGAGGGCAGAAGG + Intergenic
966152932 3:176884636-176884658 TCAAGTGCTCAGTAGGCATATGG - Intergenic
966322792 3:178719479-178719501 CCCTGTTATCAGAAGGCAGTGGG + Intronic
966532088 3:180992464-180992486 TCAGGAGATCAGAAGGCAGGAGG + Intergenic
967100771 3:186213761-186213783 CCAAGTGATCATTATGCAGATGG + Intronic
967419839 3:189260782-189260804 CTAAGTCAACAGGAGGCAGATGG - Intronic
968121333 3:196128084-196128106 CTAAGTGATGAGAAAGCAGCAGG + Intergenic
969260603 4:6030921-6030943 CCAGGTGATGAGGACGCAGACGG + Intronic
969576453 4:8038816-8038838 CCAATTTCCCAGAAGGCAGAGGG - Intronic
971995076 4:33954995-33955017 CCCAGTGATCTGAATGCAGAAGG - Intergenic
972174429 4:36386142-36386164 GCAGGAGATCAAAAGGCAGAAGG - Intergenic
973910052 4:55571234-55571256 TGAATTGATCAGAAGTCAGAAGG - Intronic
975395696 4:73870529-73870551 CCAACTGACCAGAAGGGAGGAGG + Exonic
975415170 4:74097741-74097763 CCAACTGACCAGAAGGAAGGAGG - Exonic
976298251 4:83493534-83493556 CCAACTGCTCAGGAGGCTGAAGG - Intronic
976399111 4:84587658-84587680 GCAAGTCTTCAGAGGGCAGAGGG - Intronic
977945809 4:102912762-102912784 CCAAGTACTCAGTAGGCTGAGGG + Intronic
978757085 4:112314278-112314300 CTAAGTGAGCAGAAGGTAAACGG + Intronic
979269359 4:118742218-118742240 CCAAGTGATGTGTAGGCAGGGGG - Intronic
980052928 4:128055867-128055889 CCAAGTACTCAGGAGGCTGAGGG + Intergenic
980706659 4:136505336-136505358 GAAAGTGCACAGAAGGCAGATGG + Intergenic
982527490 4:156497752-156497774 CCAGGTCTTCAGATGGCAGAAGG + Intergenic
982536909 4:156618408-156618430 CCAAATGAGCAGATGGCTGAGGG - Intergenic
983921433 4:173349818-173349840 CCAGGTGTTCAGAAGGCAGTGGG + Intergenic
983976642 4:173942859-173942881 CCAAGGGTGCAGAAAGCAGAGGG + Intergenic
984204813 4:176773795-176773817 CCAAGTACTCCGAAGGCCGAGGG - Intronic
985565579 5:613926-613948 CCAAGTGATCCTGAGGCAGTAGG + Intronic
985726640 5:1519764-1519786 CCAGGTCATCAGAAGGCAGCTGG + Intronic
986488316 5:8263290-8263312 CCAAGTTATCACAAAACAGAGGG + Intergenic
986642815 5:9888855-9888877 CCAAGATAGCAGAAGACAGATGG + Intergenic
987609444 5:20182725-20182747 CTAAGTCCTCAGATGGCAGAAGG - Intronic
987689770 5:21251841-21251863 ACAAAAGATCACAAGGCAGAAGG - Intergenic
988047000 5:25969394-25969416 ACAAAAGATCACAAGGCAGAAGG - Intergenic
988991830 5:36679218-36679240 GCAAGGGAGCAGGAGGCAGAGGG + Intronic
990725151 5:58745092-58745114 CCAACTGTTCAGAAAGTAGATGG + Intronic
991528120 5:67585955-67585977 CCAGGTGTTCAGAAGGAGGAAGG + Intergenic
993411318 5:87576655-87576677 ACAAAAGATCACAAGGCAGAAGG - Intergenic
993573969 5:89578553-89578575 ACAGGTGATCAGAAGAAAGATGG + Intergenic
993790942 5:92210407-92210429 CTTAGAGATCAGAAGCCAGATGG + Intergenic
995242522 5:109901199-109901221 ATAAGTGGTCAGAAGGCACAGGG + Intergenic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
999374625 5:151078277-151078299 CCTAGAGATGAGAAGGCAGGAGG - Intronic
999742404 5:154566241-154566263 GCAAGGGATCTGAAGGCAGGAGG + Intergenic
1000565372 5:162840685-162840707 ACAAGTTATCAGAAGACAAAGGG - Intergenic
1003802008 6:9680750-9680772 ACAAAAGATCACAAGGCAGAAGG + Intronic
1005817277 6:29564398-29564420 CCAGCTGCTCAGAAGGCTGAGGG - Intronic
1006175667 6:32119963-32119985 GCAAGTGAGCAGAGGTCAGAGGG + Intronic
1007122782 6:39397157-39397179 ATAACTGATCAGAAGGGAGAAGG - Intronic
1007384790 6:41513182-41513204 CAAAGAGATTAGAAAGCAGAAGG - Intergenic
1009039096 6:58156140-58156162 TCAAGGGATCACAAGGCAGAAGG - Intergenic
1009214989 6:60910979-60911001 TCAAGGGATAACAAGGCAGAAGG - Intergenic
1010825858 6:80473863-80473885 CCAGCTGCTCAGAAGGCTGAAGG + Intergenic
1011518604 6:88179909-88179931 GCAGGTGATCAGAGGGCAGGAGG - Intergenic
1012380732 6:98616356-98616378 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1013772305 6:113641515-113641537 CCCAGTGATCAGAAAGCTGAGGG - Intergenic
1013927727 6:115493367-115493389 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1014018703 6:116564289-116564311 CCAAGTGGGAAGAAGGGAGAAGG - Intergenic
1017854605 6:158339312-158339334 ACAAAAGATCACAAGGCAGAAGG + Intronic
1018059821 6:160081426-160081448 ACAAGAGGTCACAAGGCAGAAGG + Intronic
1018321615 6:162616197-162616219 CAAAGTCTTCAGAAGGCAGTGGG - Intronic
1018366832 6:163129650-163129672 CCCTGTGATCAGTAGGAAGATGG - Intronic
1018600645 6:165536126-165536148 CCAAGAGAACAGAACACAGATGG + Intronic
1019194677 6:170274160-170274182 GCTGGTGCTCAGAAGGCAGATGG - Intergenic
1021020067 7:15586942-15586964 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1021456232 7:20832104-20832126 CCAAGTGATAGGAAGGAAGAGGG + Intergenic
1021898285 7:25258040-25258062 CCAGGTGATTACAATGCAGAGGG + Intergenic
1022999321 7:35791179-35791201 AGAACTGATCAGAAGGGAGAGGG + Intergenic
1023246093 7:38205818-38205840 AACAGTGATTAGAAGGCAGAGGG - Intronic
1023677013 7:42641411-42641433 CCAAGTGATCCAGAGGCAGCAGG - Intergenic
1024053132 7:45642150-45642172 CCAGGTCATCAGCAGGCAGAAGG + Intronic
1024340195 7:48249999-48250021 CCAATTGATCAGAAGTGAGAAGG - Intronic
1024891940 7:54213203-54213225 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1024946158 7:54809297-54809319 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1025732143 7:64116483-64116505 CCAAGTCTACAGCAGGCAGAAGG + Intronic
1025870154 7:65423688-65423710 GCAAAAGATCACAAGGCAGAAGG - Intergenic
1025927734 7:65972884-65972906 CCAAGTCTGCAGCAGGCAGAAGG - Intronic
1026455701 7:70570777-70570799 ACAAGAGATCAGATGGGAGATGG - Intronic
1027454534 7:78373070-78373092 CCAGGTACTCAGAAGGCTGAGGG - Intronic
1029866390 7:103635235-103635257 TCAAATGATCAGAAGTCAGTGGG + Intronic
1029913042 7:104175119-104175141 CCAAGGAAGCACAAGGCAGAAGG - Intronic
1030442474 7:109604495-109604517 CCAAGCGAGCAGAAGGCCCAGGG - Intergenic
1031255207 7:119438082-119438104 GCATGTGGTCACAAGGCAGATGG + Intergenic
1031513923 7:122679545-122679567 ACAAAAGATCACAAGGCAGAAGG - Intronic
1032072956 7:128820711-128820733 CCAAGAGATCCGGAGGCTGAGGG - Intronic
1032803332 7:135333957-135333979 CAAAGTCATCAGAAGGCAGAAGG + Intergenic
1034674736 7:152884315-152884337 CCAGGGGAGCAGGAGGCAGAAGG + Intergenic
1036761021 8:11508617-11508639 CCAGGAGACCCGAAGGCAGAGGG - Intronic
1037222894 8:16547039-16547061 CCAAGTGGTCAGTAAGCACATGG + Intronic
1037462260 8:19123124-19123146 GGAAGAGATCAGATGGCAGAAGG + Intergenic
1037603141 8:20415714-20415736 CCAGGTGGTAAGAAGGGAGAGGG + Intergenic
1038778915 8:30554609-30554631 CCAGGTGATCACCAGGCACATGG - Intronic
1039111367 8:34043849-34043871 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1040091641 8:43404726-43404748 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1041080748 8:54212723-54212745 CAAAATGCTCAGATGGCAGAGGG + Intergenic
1041847923 8:62352982-62353004 TCAAGTAACAAGAAGGCAGATGG - Intronic
1042355587 8:67824152-67824174 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1044003436 8:86913660-86913682 ACAAAAGATCACAAGGCAGAAGG + Intronic
1044061556 8:87643045-87643067 TAAAATGATCAGAAGGCAAAAGG - Intergenic
1045148660 8:99377863-99377885 ACAAAAGATCACAAGGCAGAAGG + Intronic
1046187877 8:110746687-110746709 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1046707916 8:117476818-117476840 CCAAATATTCAGAAGACAGATGG - Intergenic
1048397328 8:134026503-134026525 CAAAGGGATCAGAAGGAAGTTGG - Intergenic
1048517048 8:135120695-135120717 CAAGGACATCAGAAGGCAGAAGG - Intergenic
1049024822 8:139981115-139981137 CCCAGTGATTAATAGGCAGAGGG - Intronic
1049363546 8:142225555-142225577 CCCTGTGGTCAGAAGGCAGAGGG - Intronic
1050372938 9:4940867-4940889 CCAGCGGAGCAGAAGGCAGATGG + Intergenic
1055278809 9:74650408-74650430 CCAATTGATCACAAGGTTGATGG + Intronic
1055385634 9:75759146-75759168 GCAAATGATAAGAAGCCAGATGG + Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056708208 9:88969385-88969407 GCAAGTGATGAGAAGGGCGAGGG + Intergenic
1056722694 9:89085319-89085341 AAAAGTGAACAGAAGGCTGAGGG - Intronic
1057281954 9:93719791-93719813 CCAAGTCATCAGAAGGAACAAGG - Intergenic
1059356068 9:113700403-113700425 CCAGGTGATAACAAGGGAGAAGG + Intergenic
1059826135 9:118030951-118030973 CCAAGTGATCAGATAACATATGG + Intergenic
1060418485 9:123450178-123450200 CCAAGTGAGCAGAACCCAGTGGG - Intronic
1060738770 9:126083890-126083912 CCAAGTGGCCAGAAAGAAGAAGG - Intergenic
1062166059 9:135107857-135107879 CAAAGAGATCAGAAATCAGAGGG - Intronic
1062701049 9:137903398-137903420 CCAAGTGATGAGAAGGTGAAGGG - Intronic
1186598217 X:11007429-11007451 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1186994509 X:15105740-15105762 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1188446199 X:30255665-30255687 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1188776506 X:34226461-34226483 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1189437481 X:41005890-41005912 TAAAGAGAGCAGAAGGCAGAAGG - Intergenic
1193141636 X:78033947-78033969 TTAAATGATCAGAAGGCATAGGG - Intronic
1194532188 X:95064116-95064138 CCAGGTGATCACAAGGAAGTGGG + Intergenic
1194944190 X:100048613-100048635 GCAGGTGAACAGAAGGCAGAAGG + Intergenic
1195416356 X:104623766-104623788 CCAAGTCATCTGAAGGATGAAGG + Intronic
1195871163 X:109487771-109487793 CCCAGTGATTAGAAACCAGATGG - Intergenic
1196944271 X:120808674-120808696 CAAAAAGATCAGAAGGCAAAGGG - Intergenic
1197999053 X:132412884-132412906 CCAAGTTATCAAAAGTCAGAAGG + Intronic
1198037258 X:132813479-132813501 CCACGTGTTCAGTAAGCAGATGG - Intronic
1198994743 X:142561378-142561400 ACAAAAGATCACAAGGCAGAAGG - Intergenic
1201722401 Y:17114426-17114448 CTAAGGGATCCAAAGGCAGAAGG - Intergenic
1202255159 Y:22913364-22913386 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1202408150 Y:24547113-24547135 ACAAAAGATCACAAGGCAGAAGG + Intergenic
1202462632 Y:25122967-25122989 ACAAAAGATCACAAGGCAGAAGG - Intergenic