ID: 1104871428

View in Genome Browser
Species Human (GRCh38)
Location 12:132001085-132001107
Sequence CTCTCGTCTCCACACACGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104871428_1104871433 28 Left 1104871428 12:132001085-132001107 CCCACCGTGTGTGGAGACGAGAG 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1104871433 12:132001136-132001158 AGATAAAAGAAAAGACAGCTGGG 0: 98
1: 133
2: 71
3: 173
4: 1526
1104871428_1104871432 27 Left 1104871428 12:132001085-132001107 CCCACCGTGTGTGGAGACGAGAG 0: 1
1: 0
2: 1
3: 2
4: 80
Right 1104871432 12:132001135-132001157 GAGATAAAAGAAAAGACAGCTGG 0: 95
1: 134
2: 69
3: 122
4: 1087

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104871428 Original CRISPR CTCTCGTCTCCACACACGGT GGG (reversed) Intronic
906668161 1:47636333-47636355 TTCTCGTCTCCCCACCCGTTAGG + Intergenic
906682313 1:47737186-47737208 GTCTCCTCTCCACACCCTGTGGG - Intergenic
914926431 1:151892825-151892847 CTCTCTTCTCCACACTCCATTGG - Intronic
915623347 1:157099373-157099395 CTCCCCTCTCCACCCAGGGTTGG - Exonic
916657442 1:166888710-166888732 CTCTAGTCTCCCCAAACAGTGGG + Intergenic
917035815 1:170745838-170745860 CTCTCTTCTCCACACCCATTAGG - Intergenic
920048246 1:203147462-203147484 CTCTCTTCCCCAAACAAGGTTGG + Intronic
1072249747 10:93572274-93572296 CTCTCATCTTCACACTCAGTGGG - Intronic
1074803456 10:117025653-117025675 CTCTCCTCTCCTCAAGCGGTGGG - Intronic
1083876905 11:65529075-65529097 CTGTCTTCCCCACACACGGCTGG - Intronic
1086882739 11:92169042-92169064 CTCTCATCTCCCAAGACGGTGGG + Intergenic
1092221544 12:6716993-6717015 CTCTAGTCTCCTTACACGGTGGG + Intergenic
1094769298 12:33635824-33635846 CTCTCTTCTCCACAAACTCTAGG + Intergenic
1095985793 12:47998764-47998786 CTCTCTTCCCCCCACAGGGTAGG + Intronic
1101819626 12:108173727-108173749 CACTGGTCTGCACACACAGTCGG + Intronic
1102490298 12:113286484-113286506 CTCTCCTCTCCAGACACGCAGGG - Intronic
1104724131 12:131065785-131065807 CTCTCTTCCCCACATAAGGTAGG + Intronic
1104871428 12:132001085-132001107 CTCTCGTCTCCACACACGGTGGG - Intronic
1105019867 12:132808883-132808905 CTCTCGTCGCCGCACACAGGGGG - Intronic
1109164602 13:59018317-59018339 CTGTTGTCTCAACACACTGTAGG - Intergenic
1109522802 13:63534538-63534560 CTCTCCTCTCCTCAAACGGAAGG + Intergenic
1110219409 13:73058252-73058274 CCCTCCTCCCCACACACGGATGG + Intronic
1110275025 13:73633290-73633312 CCCCAGTCTCCACAAACGGTGGG + Intergenic
1113067803 13:106389715-106389737 CTCTCGTATCCACACGGGGAAGG + Intergenic
1125979631 15:43988711-43988733 CTCCCGTGTCCACACAGGGGAGG - Intronic
1126674227 15:51145629-51145651 CTCTGGTCTCCTCACAAGGATGG + Intergenic
1127699618 15:61485509-61485531 CTCTCCTCTGCACATATGGTGGG + Intergenic
1127958165 15:63871015-63871037 CTCTCGTGTCCTCACATTGTGGG + Intergenic
1128590193 15:68888560-68888582 CTCTCTTCTGAACACTCGGTGGG + Intronic
1141395493 16:83700995-83701017 GTCTCGACTCCACACTTGGTGGG - Intronic
1141800410 16:86304151-86304173 CCCTGGTCTCCCCACACGGCCGG - Intergenic
1143499922 17:7332606-7332628 CTCTCGTCTCTGCACACGGTGGG - Intergenic
1147499152 17:40945646-40945668 TTCTCTGCTCCACACAGGGTAGG - Intergenic
1159900622 18:74041481-74041503 CTGTAGTCTCCACATACAGTGGG - Intergenic
1164837487 19:31366683-31366705 CTCTCTTCTCCACACACTGCAGG + Intergenic
1166719343 19:44988359-44988381 CCCTCAGCTCCACACCCGGTGGG - Intronic
927482642 2:23466568-23466590 ATCTCGGGCCCACACACGGTAGG - Intronic
941716210 2:168766231-168766253 CTCTGCTCTACACACAGGGTTGG - Intronic
943732483 2:191317298-191317320 CTTTCGTCTCCAAAAACTGTTGG - Intronic
944631788 2:201634202-201634224 CTCTTTTCTGCACACAGGGTAGG + Intronic
945048631 2:205802811-205802833 CTCCCTTCTGCACAGACGGTGGG + Intergenic
1169618022 20:7471738-7471760 CTCTCCTCTCCTCAAACAGTAGG + Intergenic
1173523681 20:43716666-43716688 CTCTCGTCTCTGCACCCAGTGGG + Intergenic
1175449040 20:59046821-59046843 TTCTCGTCTCCTCACAAAGTGGG + Intergenic
1177701365 21:24643690-24643712 CTCTTGTTTCCATACACGATGGG + Intergenic
1178761261 21:35405010-35405032 CTCTCATCACCACACACAGGAGG + Intronic
1180780882 22:18518803-18518825 CTCTCACCTCCCCACAAGGTAGG + Intergenic
1180787699 22:18556266-18556288 CTCTCACCTCCCCACAAGGTAGG + Intergenic
1181164459 22:20975966-20975988 CGTTCATCTCCACACACCGTGGG - Intronic
1181234040 22:21439040-21439062 CTCTCACCTCCCCACAAGGTAGG - Intronic
1181244607 22:21495791-21495813 CTCTCACCTCCCCACAAGGTAGG + Intergenic
1184100439 22:42339185-42339207 CGCTCGTCCTCACACAAGGTGGG + Intronic
1184504138 22:44890969-44890991 CTCTCTTCCCCACACGCGGGCGG - Intronic
950238682 3:11347860-11347882 CTCCTGTTTCCACACAGGGTTGG + Exonic
954488102 3:50873447-50873469 CTCTCCTCTCCTCACACAGAAGG + Intronic
956188087 3:66581429-66581451 CTCTCCTCTACACACAAGGCTGG - Intergenic
962050890 3:131814454-131814476 CTCCCTTCTGTACACACGGTAGG - Intronic
969644182 4:8416986-8417008 CTCACGTCTCCACCCACCGCCGG + Intronic
980869249 4:138592554-138592576 CTCTCCTCTCCAAACAAGGCTGG - Intergenic
981466228 4:145075796-145075818 CTCTGGGCTCCACACAGGCTGGG - Intronic
984810843 4:183795732-183795754 CACAGGTCTCCCCACACGGTGGG + Intergenic
987861465 5:23492666-23492688 CTCTGGGCTCCACAAAGGGTGGG + Intergenic
988696143 5:33624344-33624366 CTCTCTTCCCCACAGATGGTTGG - Exonic
999295124 5:150454702-150454724 CTCTCTTTTCCCCACAAGGTGGG + Intergenic
1000608645 5:163351433-163351455 CTCTTCTCTCCACACACTCTGGG - Intergenic
1003123910 6:3340060-3340082 CTCTCCTCTCCCCACAGGGGAGG + Intronic
1003425157 6:5994368-5994390 CTCTCCTCCCCTCACCCGGTGGG + Intergenic
1007322063 6:41034653-41034675 CTCTCATCTCCGCATACAGTTGG - Intronic
1009517848 6:64642483-64642505 CTCTCATCTTCACTCACAGTAGG - Intronic
1009978684 6:70701036-70701058 CTCTTCTCTCCTCACACGGAAGG + Intronic
1011526880 6:88275528-88275550 CTCCCGAGTCCACACACGGGAGG - Intergenic
1012805050 6:103883306-103883328 ATCTCATCTCCACAGACAGTAGG - Intergenic
1016431269 6:143988758-143988780 CTCTCCTATCCTCACAAGGTAGG + Intronic
1021493414 7:21245670-21245692 CTCTCCTCTCCACAATCTGTAGG + Intergenic
1024200847 7:47104153-47104175 CTCTTGTCTCCCCACGCGGAAGG + Intergenic
1031654928 7:124343148-124343170 CCCTCTTCACCACACACTGTGGG + Intergenic
1035133252 7:156675302-156675324 CCCTCGTCTCCAAAGACGGAGGG - Intronic
1035537142 8:400580-400602 CTCTCCCCTCCAGTCACGGTGGG + Intergenic
1041028619 8:53712587-53712609 CTCTCCTCTCTACACTCGGCAGG - Intergenic
1044553396 8:93536365-93536387 CTCTCTCCTCCACAGAAGGTGGG + Intergenic
1044656915 8:94557919-94557941 CTCCCTACTGCACACACGGTTGG + Intergenic
1188806016 X:34590716-34590738 CTCTCTGTTCCACACACAGTCGG - Intergenic
1193917074 X:87378778-87378800 CTCTCCTCTCCTCAAACAGTAGG - Intergenic
1194774304 X:97944098-97944120 CTCTAGACTCCACACAGGCTGGG - Intergenic