ID: 1104871850

View in Genome Browser
Species Human (GRCh38)
Location 12:132005060-132005082
Sequence GCTCAGCTGCAGAGGGTTGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104871850_1104871859 11 Left 1104871850 12:132005060-132005082 CCCGCAACCCTCTGCAGCTGAGC 0: 1
1: 0
2: 3
3: 17
4: 214
Right 1104871859 12:132005094-132005116 GACCTGATGAAGCTGTACGAAGG 0: 1
1: 0
2: 0
3: 7
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104871850 Original CRISPR GCTCAGCTGCAGAGGGTTGC GGG (reversed) Exonic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900375228 1:2351181-2351203 GCACAGCTGCCCAGGGTGGCCGG + Intronic
900398504 1:2463159-2463181 GCTCACCTCCAGGGGGCTGCAGG + Intronic
901027603 1:6286892-6286914 GCACCGCTGGAGAGGCTTGCAGG + Intronic
901080686 1:6582150-6582172 GCTCAGCTGCACAGGGCTTTCGG - Exonic
902420211 1:16273070-16273092 ACTCAGTTGGAGAGGGTTTCTGG - Intronic
903233631 1:21936460-21936482 GCATAGCTGCAGGGCGTTGCTGG - Intronic
903759639 1:25689005-25689027 GATCAGCCGCAGTGGGTGGCTGG + Intronic
903809107 1:26024688-26024710 GCTGAGCTGCAGGGGCTTGGGGG - Intronic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
905106682 1:35567344-35567366 GCTCATCTGCTGAAGCTTGCAGG - Intergenic
905283575 1:36864733-36864755 GCTTAGCTGCAAAGTGTTGTAGG + Intronic
906870201 1:49470945-49470967 GCTTAGCTGAAGAGGGTTTTTGG - Intronic
908333520 1:63096463-63096485 TCTTAGCTTCAGATGGTTGCTGG - Intergenic
915566367 1:156715636-156715658 GCTCAATTGCAGTGGGTTGGAGG - Intergenic
917661466 1:177181391-177181413 GCCCAGCGGCAGCGGGTAGCTGG + Intronic
920296667 1:204961608-204961630 GCTAAGCTGCAGGAGGTTGGTGG - Intronic
920531820 1:206707609-206707631 ACTAAGGTGCAGAGAGTTGCAGG - Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
923435342 1:233963029-233963051 CCTCAGCTGCAGAGCCCTGCTGG + Intronic
924085026 1:240442178-240442200 GCTAAGCTACAGAGGGGTGGTGG - Intronic
1063410100 10:5830966-5830988 CCTCAGCTGCAGAGAGTCACTGG + Intronic
1064487044 10:15804206-15804228 GCTTAAATGCAGAGGGTTGGCGG + Intronic
1065971591 10:30810178-30810200 GCTCAGCGGCAGCGGGAAGCTGG - Intergenic
1067043447 10:42970604-42970626 CCGCAGCTGCAGAGGCTTCCTGG + Intergenic
1067343399 10:45421574-45421596 ACTCAGCTGACGAGGGGTGCTGG + Intronic
1067533683 10:47092730-47092752 GCACAGAGGCTGAGGGTTGCAGG - Intergenic
1067785094 10:49240057-49240079 TCTCAGCTGCCGAGGGTTTGAGG + Intergenic
1069234859 10:66058431-66058453 GCACAGCTTCAGAGGGATGGTGG - Intronic
1071069185 10:81671410-81671432 GCTCTGCTGCCCAGGGTGGCAGG - Intergenic
1073074589 10:100815832-100815854 GCCCAGCAGCACAGGGTGGCCGG - Intronic
1074032138 10:109699632-109699654 GCTCAGCTCAAGAGGGTTCTTGG - Intergenic
1075194916 10:120348119-120348141 GCTATGCAGCAGAGGGTTGGGGG - Intergenic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1076509175 10:130999945-130999967 GCTTAGCTGCAGAGTTTTGGGGG + Intergenic
1076823818 10:132957350-132957372 GCTCAGCTGCACTGAGGTGCAGG - Intergenic
1077184981 11:1231850-1231872 GCTTATCTGCAGAGGGTTCTGGG + Intronic
1077282693 11:1752831-1752853 GGTCAGCTGCAGAGGAAGGCTGG + Exonic
1084484396 11:69439357-69439379 GCTCAGATGCAGGGAGGTGCAGG - Intergenic
1084549426 11:69832186-69832208 CCTCAGCTGCTGAGAATTGCAGG - Intergenic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085046308 11:73355770-73355792 GCTGAGCTGGAGAGGCTTGCTGG + Intronic
1086794199 11:91080470-91080492 GGGCAGCTGCAGAGTGATGCTGG + Intergenic
1087297015 11:96389650-96389672 GCTCAGCTGAGGAGGGTTAGAGG + Intronic
1088913017 11:114206299-114206321 GCTGAGCTTCAGAGGGGTTCTGG + Intronic
1089455894 11:118625588-118625610 GCCCAGCTGCACAGGGGGGCAGG + Intronic
1089607023 11:119647418-119647440 GCCCAGCTGGAGAGAGTTACTGG + Intronic
1090001710 11:122966521-122966543 GCTCATTTTCAGAGGGCTGCTGG - Intergenic
1091201768 11:133786049-133786071 GCTGAGCTGCAGAGCTGTGCTGG + Intergenic
1092288099 12:7141503-7141525 GCACAGCTGCAGAGAGATGCAGG - Intronic
1093574762 12:20713665-20713687 GCTCTGCTGTAGATTGTTGCAGG - Intronic
1097815679 12:64071037-64071059 GCTCATCAGTAGAAGGTTGCAGG - Intronic
1098787900 12:74782384-74782406 AATCAGCTGCAGGGGGTTGGTGG + Intergenic
1101242753 12:102854668-102854690 ACTCAGCTGGAGAGGATTGAAGG + Intronic
1101471162 12:104998694-104998716 CATCAGCTTCAGAGGGGTGCTGG + Intronic
1101659980 12:106757243-106757265 GCTCAGCAGCAGAGGGATGGTGG + Intronic
1103009174 12:117444853-117444875 GCACAGCTTCAGAGAGTTACTGG + Intronic
1103744177 12:123110994-123111016 GCCCAGCTGGAGGGGCTTGCTGG - Intronic
1104685572 12:130782151-130782173 GGGCAGCAGCAGAGGGTCGCTGG - Intergenic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1104949319 12:132431945-132431967 GCTGAGCTGCACAGGGTCACTGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1109068692 13:57735384-57735406 TCTCAGCTGCAGGGAGATGCTGG - Intergenic
1112434662 13:99383480-99383502 GCTCAGCTGCCCAGGGCTGGTGG - Intronic
1114619150 14:24084617-24084639 GCTCAGCTCCAGGGGGCTGTGGG + Intronic
1121709574 14:96027588-96027610 GCTCTGCTGGGGAGGGTGGCAGG - Intergenic
1125548824 15:40529038-40529060 GCTCAGCTGGACAGGCTTCCAGG + Intronic
1127571991 15:60252508-60252530 GCTCAGATGCATGGAGTTGCTGG - Intergenic
1130162627 15:81416326-81416348 GCAAAGCTGCAGAGTGTCGCTGG - Intergenic
1131455580 15:92580172-92580194 GCTCTGCTTCACAGGGTTGCTGG - Intergenic
1131520340 15:93109727-93109749 GCTCAGCTGCGGAGTTTTGTTGG - Intergenic
1132285823 15:100661564-100661586 GCTCAGCTGCATTGAGTGGCTGG - Intergenic
1134450067 16:14357843-14357865 TCTCAGGTTCAGAGGGTTCCAGG - Intergenic
1137767128 16:50986494-50986516 GCTCAGCTGGAGAGGGTAAGAGG - Intergenic
1139548743 16:67661923-67661945 GCGCCGCTGCAGAGAGTTGGAGG - Exonic
1140520040 16:75572996-75573018 GCTAAGCTGCACAGGCTTGCTGG - Intronic
1140700312 16:77575282-77575304 ACTCAGCTGCAGGGTTTTGCAGG + Intergenic
1140927703 16:79599597-79599619 GTTCAGCTGCTGCGGGTAGCCGG + Exonic
1141964373 16:87431936-87431958 CCTCAGCTGCTGAGGTTTGGAGG - Intronic
1142230755 16:88899224-88899246 GCTCAGTTGCAGAGCCCTGCCGG - Intronic
1143928500 17:10395163-10395185 GCTTAGCTGCAGAGAGTTTAAGG - Exonic
1144497520 17:15757884-15757906 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144629313 17:16862368-16862390 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1144652112 17:17013747-17013769 CCTCAGGTGCAGGGGGTAGCGGG + Intergenic
1145160884 17:20572934-20572956 CCTCAGGTGCAGGGGGTAGCGGG - Intergenic
1147629920 17:41923520-41923542 ACTCACCTGCAGCAGGTTGCAGG - Intronic
1147671540 17:42179823-42179845 GTTCTGCTGCTGGGGGTTGCTGG - Intronic
1148341718 17:46877202-46877224 GCTCAGGTGCAGTGGGCTCCAGG + Intronic
1148358133 17:46989916-46989938 GCTCAGCTGCAGAGCTCTGCTGG - Intronic
1151435003 17:74089692-74089714 GGTCAGCTGCAGATTGATGCTGG - Intergenic
1152296783 17:79472069-79472091 GCACACCTGCAGAGGGCAGCTGG - Intronic
1155443416 18:25885201-25885223 GCTCAGCTGCAGTGGGGTAGAGG + Intergenic
1156144616 18:34159883-34159905 TCTCAGCGGGAGAGGGATGCGGG + Intronic
1158306377 18:56110455-56110477 GCTCTTCTGCAGAGGGTTCAAGG - Intergenic
1159013333 18:63080525-63080547 GCTCTGCTGCAGCTGGTAGCAGG + Intergenic
1160208655 18:76858668-76858690 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208682 18:76858756-76858778 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208709 18:76858844-76858866 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208723 18:76858888-76858910 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208779 18:76859064-76859086 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160208793 18:76859108-76859130 GCTCAGCTGGAGGCGGGTGCAGG + Intronic
1160321434 18:77900004-77900026 GCTCAGCTGGAGAGGGTAGAGGG - Intergenic
1161315241 19:3614584-3614606 GCTCACCTGCAGCGGGGTGGGGG + Exonic
1161746651 19:6064228-6064250 GCTCAGCTGAAGACGGGAGCTGG - Intronic
1161994872 19:7705986-7706008 GCTCAGCTGGAGATGGTTGAGGG - Intergenic
1165068883 19:33243837-33243859 GCTGAGCAGCAGAGGGGTGCTGG - Intergenic
1165476193 19:36032427-36032449 GGTCAGCTGGAGAGGGTGCCCGG + Intronic
1166641559 19:44498786-44498808 GCACACGTGCAGAGTGTTGCTGG + Intronic
1167577771 19:50325944-50325966 GCGCAGCTGCAGAGGCTGGACGG + Intronic
926561741 2:14425432-14425454 GCTCAGCAGCAGTAGGTGGCTGG - Intergenic
926652954 2:15366579-15366601 GCTGAGCTGCTGAGGGTTGCAGG - Exonic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928394734 2:30934745-30934767 GCTCAGAGGCAGAGCGTTGAGGG - Intronic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
932335345 2:70927948-70927970 GCACAGCTGCGGAGGTGTGCTGG + Intronic
933603216 2:84354461-84354483 GCTCTGTCCCAGAGGGTTGCGGG - Intergenic
933698015 2:85234870-85234892 GCTCTGCAGGAGAGGGTTGCTGG + Intronic
933719857 2:85390989-85391011 GCTGAGCTGCAGGGGCTTTCAGG + Exonic
937523549 2:122739952-122739974 GCTCAGCTGCAGGAGCTTGTTGG + Intergenic
938244941 2:129769093-129769115 GCTCACCTGCAGAGGCTGACGGG - Intergenic
942147874 2:173043948-173043970 GCTCAGCTGGAGAGAGTTCTTGG + Intronic
945178469 2:207067213-207067235 GCTCAGCTGCTGAGGGGAGAAGG - Intergenic
946154340 2:217797350-217797372 GGCCAGCTGCAGAGGGATGTAGG - Intergenic
947929021 2:233947654-233947676 GCTCAGTTGCTCAGTGTTGCAGG - Intronic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1174309935 20:49644373-49644395 GCTCAGCTGCAGCCAGGTGCAGG - Intronic
1174647970 20:52102444-52102466 GCTCAGATGCTCAAGGTTGCAGG + Intronic
1175414951 20:58795000-58795022 GGTCAGCTGCTGACGGTTACAGG + Intergenic
1175418920 20:58819209-58819231 GCACAGCTGCAGAAGGTTCCAGG + Intergenic
1175576922 20:60067277-60067299 GCACAGCTGGAGAGGGTAGGAGG + Intronic
1175986691 20:62767726-62767748 GCTCAGAAGCAGATGGTGGCTGG - Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1177664012 21:24128478-24128500 GCTCAGCTCTAGAATGTTGCAGG + Intergenic
1179148467 21:38789703-38789725 GCTCAGATGCACATGGCTGCTGG + Intergenic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180065232 21:45409004-45409026 GGTCAGGTGCAGAGGCTGGCAGG + Intronic
1180744981 22:18081612-18081634 GCTTAGGTGCAGAGATTTGCTGG + Intronic
1181053742 22:20249647-20249669 ACTGAGCAGTAGAGGGTTGCTGG + Intronic
1181437255 22:22918084-22918106 GAGCAGCTGCAGGGGGTTGGGGG + Intergenic
1184047300 22:41979439-41979461 GCTCAGCTGCAGAGGCATAAGGG + Intronic
1184135903 22:42549787-42549809 GCTGAGCTCCAGGGGGGTGCTGG + Intergenic
1184275220 22:43405999-43406021 GCTCAGCTGGAGGGGGTGACTGG + Intergenic
1185038495 22:48491505-48491527 GCTGAGCTGCTGGGGGTTGGGGG - Intronic
949374002 3:3366692-3366714 GCTCAGCCACAGAGGGCTACTGG + Intergenic
949588707 3:5469802-5469824 GCTCAGGTGGAGAAGGCTGCTGG + Intergenic
954322926 3:49844229-49844251 GCTCAGCTGCTGAGTTTGGCTGG - Intronic
954416882 3:50397654-50397676 GTGCAGCTGCTGAGGGTTGGAGG - Intronic
956794691 3:72707087-72707109 GCTCAGCTGCAGAGGGGCCTGGG - Intergenic
961033105 3:123623611-123623633 GCACAGCTGCAGAGAGTTCTGGG + Intronic
961635280 3:128329310-128329332 GCACAGCTGCACTGGGGTGCAGG + Intronic
961869646 3:129978034-129978056 GCTCTGCTGCAGAGGGAATCAGG + Intergenic
961964307 3:130887197-130887219 GCTGAGCTGCCTAGGGCTGCAGG + Intronic
962108482 3:132417609-132417631 GCTCCGCTGCCGCGGGTTCCTGG - Exonic
963063703 3:141245530-141245552 GCTCAGTTGTTCAGGGTTGCTGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968549701 4:1215895-1215917 GCCCAGGTGCAGATGGCTGCTGG + Intronic
968632799 4:1660946-1660968 GCACAGCTGCACAGGGCTGGAGG + Intronic
968646587 4:1744165-1744187 GCTCAGCTCCAGAGGGAGACGGG + Intronic
969184364 4:5464390-5464412 GCACTCGTGCAGAGGGTTGCAGG - Intronic
969301513 4:6300046-6300068 GTTCAGCTGCACGGGGCTGCCGG - Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
970511846 4:16788891-16788913 GCCCTGCTGCAGTGGGCTGCTGG - Intronic
971242071 4:24898206-24898228 CCTCACCTGGAGAGGGTTGGGGG + Intronic
971528166 4:27649112-27649134 GTCCAAATGCAGAGGGTTGCTGG - Intergenic
975654992 4:76632577-76632599 GCTGAACTGCAGTGGGTTGAAGG + Intronic
975994349 4:80297110-80297132 TCTCAGCCTCAGAGTGTTGCTGG + Intronic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
980180435 4:129394071-129394093 GCTGAGGTGCAGAGGATTTCAGG - Intergenic
982962626 4:161859789-161859811 GTTCATGTGCAGAGGGCTGCTGG + Intronic
985977773 5:3434565-3434587 GCTCCGCTTCAGAGGGTGGTAGG - Intergenic
986009405 5:3698656-3698678 GCTCAGCTGGAGAGGCTGGCTGG - Intergenic
986162399 5:5241593-5241615 GCTCAGATGCAGGGATTTGCAGG + Intronic
989158420 5:38367026-38367048 GCTCAGCTTTGGAAGGTTGCTGG - Intronic
990315770 5:54581922-54581944 TCTCAGCTGGGGAGGGGTGCAGG - Intergenic
994745111 5:103668402-103668424 ACGCAGATGCAGAGGGTTGAAGG - Intergenic
995281687 5:110342799-110342821 GCTAGGCTGCAGAGGGGAGCTGG - Intronic
996292398 5:121867493-121867515 CCTCAGCTGAAGAGAGCTGCGGG + Intergenic
996895013 5:128470481-128470503 GCTCAGCTGCCTAGAGTTGCTGG - Intronic
998591808 5:143486681-143486703 GCTCAGTAGCTGAAGGTTGCTGG + Intergenic
1001128857 5:169046840-169046862 GCTCTGGAGCAGAGGGGTGCTGG - Intronic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1001658839 5:173375204-173375226 GCTCAGGTGCAGAGGGACACAGG - Intergenic
1002499479 5:179638459-179638481 GCTCAGCTGGAGACTGTAGCTGG - Intergenic
1002558565 5:180063751-180063773 GCTCAACAGCTGAGTGTTGCTGG - Intronic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003500915 6:6702104-6702126 GCTCAGCTGCAGGGTGGTTCTGG - Intergenic
1013197948 6:107862434-107862456 GCTCAGCAGCAGAGATATGCTGG + Intergenic
1014991527 6:128085265-128085287 GATCAGCTGCACAGCCTTGCTGG - Intronic
1015429062 6:133108894-133108916 TCTGAACTGCAGAGTGTTGCTGG - Intergenic
1017002775 6:150007263-150007285 GCACAGGTGCAGAGGGGAGCTGG + Intergenic
1018093978 6:160368534-160368556 GCTCAGCTGCAGAGGAACACAGG - Intronic
1018947109 6:168355770-168355792 GGTCAGCTCCAGAGAGATGCAGG - Intergenic
1019025822 6:168962304-168962326 GCTCATCTGCACAGGGTTGGTGG - Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019449724 7:1091161-1091183 GCTCAGCTGCAGCTGGAGGCTGG - Intronic
1023521323 7:41052850-41052872 GCTCAGGCGCAGAGAGGTGCAGG + Intergenic
1023976194 7:45031987-45032009 TCTCAGCTGCAGGGGGTGGTAGG - Intronic
1024587653 7:50855513-50855535 GCTCTGCTGCAGAGTGAGGCTGG - Intergenic
1027052468 7:75028812-75028834 TCTGAGCTGGAGAGGCTTGCAGG + Intronic
1029649061 7:101878371-101878393 GCTAAGCTGCAGCCTGTTGCTGG - Intronic
1033171787 7:139091118-139091140 GCCCAGCTGCTGAGGGTTCTGGG - Intronic
1034502871 7:151462310-151462332 GCTCAGGGGCAGAGGTTTGGAGG - Intergenic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1037845046 8:22275521-22275543 GGGGAGCTGCTGAGGGTTGCGGG + Intronic
1038292460 8:26262146-26262168 TCTCAGCGCCAGAGGGATGCAGG + Intergenic
1040546245 8:48400216-48400238 GCTCAGGTGGTGAGGCTTGCTGG - Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1043725709 8:83608059-83608081 GCTCAAATGGAGGGGGTTGCAGG + Intergenic
1048203043 8:132392592-132392614 GCTCAGGTTAAGAGTGTTGCAGG - Intronic
1048958759 8:139558244-139558266 GCTCTGCTGGAGAGTGTTGAAGG + Intergenic
1049596205 8:143484665-143484687 GCACAGGTGCAGAGGGTCGCGGG - Intronic
1049812157 8:144580430-144580452 GCTCAGCCTCAGAGGGTTCTGGG - Intronic
1051671216 9:19512541-19512563 GGTCAGGTGCAGAGGGCAGCTGG + Exonic
1052834790 9:33242248-33242270 GCTCAGGTGCATAGGGAGGCGGG + Intronic
1054804032 9:69380937-69380959 GCTCAGCTGTAGAGGGTTGGGGG + Intronic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057294012 9:93824973-93824995 GCTGGGCTGCAGAGGGCTGTTGG - Intergenic
1058792864 9:108468879-108468901 GCTTAGCTGCGGAGGGTTCTTGG - Intergenic
1060886806 9:127160374-127160396 GCCCAGCTGCGGAGGGCTTCTGG + Intronic
1060895676 9:127215659-127215681 GCTCAGCTGCAGGGGTTACCAGG - Intronic
1061133532 9:128721172-128721194 GCCCAGCTGTTTAGGGTTGCTGG - Exonic
1061995690 9:134181617-134181639 GCCCAGCTGGAGAGGTGTGCAGG + Intergenic
1062011856 9:134271570-134271592 GCCCAGAGGCAGAGGTTTGCGGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1186349890 X:8730967-8730989 GCTTGGCTCCAGCGGGTTGCCGG - Intronic
1187406271 X:19007106-19007128 GCTCAGCTGGAGTAGTTTGCAGG - Intronic
1187914469 X:24140467-24140489 GCTTGGCTGCAGTGGGCTGCTGG + Intergenic
1190106192 X:47562665-47562687 GCTTCACTGCACAGGGTTGCGGG - Intronic
1190304734 X:49075539-49075561 GCTCACCAGTAGAGGGTGGCAGG + Exonic
1192048379 X:67700330-67700352 GCTCAGGTGCAGAGGGCAGGAGG + Intronic
1197749803 X:129956832-129956854 GATCGGCTGCATAAGGTTGCGGG - Intergenic
1198528459 X:137525544-137525566 TAGCAGCTGCAGAGGCTTGCAGG + Intergenic
1198952956 X:142093831-142093853 TCCCAGCTGCTGATGGTTGCCGG - Intergenic