ID: 1104874502

View in Genome Browser
Species Human (GRCh38)
Location 12:132024630-132024652
Sequence GAGCCCTAAACAAAAACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104874502 Original CRISPR GAGCCCTAAACAAAAACACA GGG (reversed) Intronic
901400712 1:9013631-9013653 TTGATCTAAACAAAAACACAGGG + Exonic
902794115 1:18789476-18789498 GAGCCCCAAACCAAAACTCCAGG + Intergenic
905788924 1:40779860-40779882 GAGCCCTAAACTACAAGTCATGG - Intergenic
906014371 1:42561339-42561361 GAACCAAAGACAAAAACACATGG + Intronic
906080474 1:43084800-43084822 GAACCCTAAAGTAAAATACATGG + Intergenic
909015905 1:70379356-70379378 CATCCCTAAACAATAAAACAAGG + Intronic
909525447 1:76617018-76617040 GAGCCCTAAGCAACAAGACTTGG + Intronic
911003253 1:93190161-93190183 GAGGCCTAAACAAAAGAAAAAGG - Intronic
911023333 1:93410647-93410669 GAACCCTAAAGTTAAACACATGG + Intergenic
911482567 1:98462141-98462163 GAGTCCTGACAAAAAACACATGG - Intergenic
913713556 1:121511381-121511403 GAGCCCTAAACAAAATCTGGAGG + Intergenic
914734877 1:150406341-150406363 GAACCCTAAACAAATATTCAGGG - Intronic
916411038 1:164547229-164547251 GAGTCCTAGACACAAACACAAGG - Intergenic
918021142 1:180692338-180692360 GAGCCATAAAGAAATACAGATGG + Intronic
919780982 1:201221066-201221088 GAGTCCAGAATAAAAACACATGG + Intronic
921227746 1:213037163-213037185 CAGTCAAAAACAAAAACACAAGG - Intergenic
924604564 1:245521691-245521713 GAGCACTACACAAATACAGACGG - Intronic
924902553 1:248417043-248417065 GAGCCCAAAACCAAAAGATAAGG + Intergenic
1069012115 10:63386143-63386165 CAGCCCTGAAGGAAAACACAAGG + Intronic
1071918470 10:90323246-90323268 GACCCTTAAACTAAAACAAAGGG - Intergenic
1074111690 10:110427271-110427293 GAGGCCCAAACACACACACATGG + Intergenic
1075111352 10:119587648-119587670 GATCAATGAACAAAAACACAAGG + Intronic
1076536288 10:131179662-131179684 GACCTCAAAACAAAACCACAAGG - Intronic
1078892429 11:15569401-15569423 GAACCCTGAAGAAAAACACTTGG - Intergenic
1083323490 11:61861852-61861874 GAGGCCTAAACCAGAACCCACGG - Intronic
1085809192 11:79665202-79665224 GAGCCCCAAACAATTACAGAAGG - Intergenic
1087136152 11:94722081-94722103 GAGCCATAAACAACACCACCTGG - Intronic
1088705285 11:112456611-112456633 CAGCCAACAACAAAAACACATGG + Intergenic
1089358816 11:117873117-117873139 CAGCCCTAAAGAAAAAAACTTGG + Intronic
1089611305 11:119671003-119671025 CAGCCCTAAACAAAATAACCGGG - Intronic
1092329534 12:7570605-7570627 GAGACATAAACAAACACACACGG + Intergenic
1092687249 12:11063700-11063722 GAGCCAAAAGCAAAAACAGATGG + Intronic
1094001980 12:25705528-25705550 GACCCCTAACCAATCACACAGGG + Intergenic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1096739940 12:53685680-53685702 GAGCTTTAATCAAATACACAAGG - Intergenic
1098197015 12:68012901-68012923 GAGCTCTAAACAAAAGCAAAAGG - Intergenic
1098521480 12:71439446-71439468 GAGACCTAAACAGACGCACAAGG - Intronic
1099037318 12:77604901-77604923 AAACTCTAAACAAAAACAAATGG + Intergenic
1099487343 12:83244864-83244886 GAGAGCTAAACAAGAACTCATGG - Intergenic
1099953348 12:89328266-89328288 CAACACTTAACAAAAACACAGGG + Intergenic
1101082154 12:101198119-101198141 GAGAACTAAATAAAAACACAAGG + Intronic
1103218504 12:119223235-119223257 GATCCCTAAACACAAACCCAAGG + Intergenic
1104216028 12:126734791-126734813 GAGCCAAAATCCAAAACACAAGG - Intergenic
1104874502 12:132024630-132024652 GAGCCCTAAACAAAAACACAGGG - Intronic
1105790897 13:23797703-23797725 GAGCCCTACAAAAACACAAAAGG + Intronic
1106069361 13:26392960-26392982 GAAAACTAAACAAAAACAAACGG - Intronic
1106091524 13:26599510-26599532 GGGCCTTAATCAAATACACATGG - Intronic
1106149849 13:27088636-27088658 TAGCCCCAAATAAAAACTCAGGG + Intronic
1107631292 13:42345146-42345168 AAGCACAAAACAAAAACAAAAGG - Intergenic
1107952745 13:45478886-45478908 GAGCCCTAAGCAATAAAACTTGG + Intronic
1107956442 13:45517542-45517564 CAAACCAAAACAAAAACACATGG - Intronic
1110432188 13:75437104-75437126 GAGACTTAAACATAAACAAATGG + Intronic
1110954254 13:81534320-81534342 AACCACTAAACAAAAACATAAGG + Intergenic
1112701053 13:102008645-102008667 GAGCAATAAAAAAAAACACGTGG - Intronic
1113745523 13:112741721-112741743 GAGCCACAAACAAAAACAGCCGG - Intronic
1114669931 14:24404874-24404896 GAGCACCACACAAAAAAACATGG - Intronic
1120467921 14:84885055-84885077 GAGTCCTAAACAAACTCAAAAGG + Intergenic
1120693171 14:87615924-87615946 GAGCACTAAGCACAAAGACACGG - Intergenic
1122611655 14:102987660-102987682 AAACCAGAAACAAAAACACAAGG + Intronic
1122953044 14:105056449-105056471 GAGCCAGAATCCAAAACACAAGG + Intronic
1124129932 15:26974445-26974467 GGGCCATAGACAATAACACAGGG + Intronic
1124149948 15:27168444-27168466 GAGTCCTAAGAAAAAACAGAAGG - Intronic
1124870388 15:33535727-33535749 GAGCCTTAAATAAAAATAAAGGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1127685201 15:61336800-61336822 GAGTATTAAATAAAAACACATGG - Intergenic
1132018953 15:98343950-98343972 GAGCCATAAAATGAAACACATGG - Intergenic
1132195818 15:99913974-99913996 GTGCCTCAAACATAAACACATGG + Intergenic
1133488521 16:6244279-6244301 GACCGCCAAACAAAAACACGTGG - Intronic
1134262294 16:12661566-12661588 GAGGAAAAAACAAAAACACAAGG - Exonic
1135752907 16:25071031-25071053 GGGCCCTGAACACAAACCCAGGG - Intergenic
1139565164 16:67770555-67770577 GAGGCCAAGAAAAAAACACAAGG + Intronic
1139679350 16:68548961-68548983 GAGGATTAAAAAAAAACACATGG - Intronic
1140445684 16:75025849-75025871 GAGCTCTAAAAGAAAACACCAGG + Intronic
1140631198 16:76854568-76854590 GAGCGCTAATGAGAAACACACGG - Intergenic
1141908408 16:87042452-87042474 GAGCCATCAACAAAAGCAAAGGG + Intergenic
1145243656 17:21253570-21253592 CAGCCCCAAACAAAACAACACGG + Intergenic
1146413073 17:32605636-32605658 TAGCCCAAAACAAAAAAAGAAGG + Intronic
1146657012 17:34640490-34640512 GAGCCCAAAGCAGAACCACAGGG + Intergenic
1147553756 17:41463398-41463420 GAGCCCTCAAAAAATACCCATGG + Intronic
1148220003 17:45854440-45854462 GGGCCCTAAACGCAAGCACATGG + Intergenic
1148709485 17:49667287-49667309 GAGCCTTAAAAAAAAAAAAAAGG + Intronic
1149311234 17:55395996-55396018 GTGGCCTGAACAAAATCACATGG + Intronic
1149975007 17:61256602-61256624 GACACCTAAACAAAACCAAACGG - Intronic
1149989359 17:61373005-61373027 GAGCACTAAAAAGAAAGACAAGG - Intronic
1150777929 17:68096713-68096735 GAGACATAAACATAAACCCAAGG + Intergenic
1150884334 17:69067935-69067957 GAAACCTAAACAGAAACACTGGG + Intergenic
1152623208 17:81376247-81376269 CATCCCTAAAGAAACACACAAGG - Intergenic
1153668629 18:7389102-7389124 GATCTGTAAACAAAAACAAATGG - Intergenic
1154248502 18:12721960-12721982 GAACACGGAACAAAAACACAAGG - Intronic
1156200631 18:34827575-34827597 GAGGCCTAAAACAAAACACAGGG - Exonic
1156739063 18:40301668-40301690 GACTCCTAAAAAAAAATACAAGG - Intergenic
1157326618 18:46673824-46673846 GACCTCTAAACAATAGCACAAGG + Intronic
1158297684 18:56016576-56016598 TAGCTTAAAACAAAAACACATGG + Intergenic
1158691417 18:59664522-59664544 CAGCCCTAAATATAAACAAAGGG + Intronic
1159298506 18:66529281-66529303 GAGACATAAACATAAACATATGG - Intronic
1162323005 19:9980855-9980877 GAACCCTGAACAAAAAAAAAAGG + Exonic
1162827405 19:13261860-13261882 GAGCCCAACACAGAAAAACAAGG + Intronic
1163814096 19:19453190-19453212 AAGCCCTAAGGAAAAGCACAGGG - Intronic
1167471693 19:49679287-49679309 GAGCCCCAAACAAAACCAGCTGG - Intronic
925840914 2:7991080-7991102 AAGCCCTAAGCAAGAACACATGG + Intergenic
927683187 2:25153694-25153716 GATGCCTAGACACAAACACACGG - Exonic
928467202 2:31533198-31533220 CAGTCCTATACAAAAACACTGGG + Intronic
929005340 2:37387999-37388021 GAGCCTGAAACAAAAGCTCATGG - Intergenic
933041448 2:77472331-77472353 TATCTCTAAACAGAAACACATGG + Intronic
933523559 2:83406470-83406492 GATCTCTATACAAATACACATGG - Intergenic
935803038 2:106717590-106717612 GGGCCCGAAAAAAAAACAAAAGG - Intergenic
936047844 2:109200786-109200808 GAGCACAGAAGAAAAACACAGGG + Intronic
937632687 2:124121314-124121336 GAACCCTGACCAAAAACACAAGG + Intronic
938807928 2:134824066-134824088 GAGCCATAAATAAAGACAGAAGG + Intergenic
939517934 2:143192407-143192429 CACCCCTAAATAAACACACAAGG + Intronic
940457637 2:153921403-153921425 GGGAGCTAAACAAGAACACATGG + Intronic
941071420 2:160959124-160959146 GAGCCCTAAAATAAAATACCAGG + Intergenic
941107411 2:161371916-161371938 GAGAACTAAACAAGAACAAAAGG - Intronic
944591849 2:201225233-201225255 GAGACTTTAACAAAGACACATGG - Intronic
947765993 2:232637748-232637770 TAGCCCCAAACAAAAAGACAGGG - Intronic
948746850 2:240102948-240102970 AAGCCCCAAACCAAAACAAATGG + Intergenic
949071674 2:242028747-242028769 AACCCTTAGACAAAAACACAGGG + Intergenic
1170290608 20:14764456-14764478 GAGCACCAAAAAAAGACACATGG - Intronic
1172456409 20:35077814-35077836 GAGCCCAAAAGGATAACACAGGG + Intronic
1173214737 20:41070398-41070420 TATCTCTAAACAAAATCACAAGG - Intronic
1175300709 20:57940878-57940900 GAGCCCTCAACAGAAATGCACGG + Intergenic
1175359409 20:58396516-58396538 GAGCTCTAAACCACATCACAAGG - Intronic
1175572629 20:60035764-60035786 GAGCCCCAAATAAAACCACCAGG - Intergenic
1179390086 21:40980460-40980482 GGGGCCTACATAAAAACACATGG + Intergenic
1179898956 21:44379027-44379049 GAGCCCTCCACAACCACACAGGG - Exonic
1180114241 21:45686834-45686856 AAGACCCAAACTAAAACACAAGG + Intronic
949302793 3:2604188-2604210 GAGATTTATACAAAAACACATGG - Intronic
954005378 3:47586451-47586473 GAGTCCAGAACAAAAACAAAAGG + Exonic
955797750 3:62655441-62655463 CAGCCCAAAACAAAAATAAATGG - Intronic
956708286 3:72018315-72018337 TAGGCCTAAACTGAAACACAAGG - Intergenic
960269185 3:115656050-115656072 GGGACATAAACAAAAACACAGGG + Intronic
960361505 3:116717560-116717582 GGGCCCAAAACAGAAATACATGG + Intronic
960453987 3:117847215-117847237 GAGCTTTAAATAAAAACAGAGGG - Intergenic
962457552 3:135578782-135578804 GAACCCTAAATGAATACACAGGG - Intergenic
962462335 3:135625778-135625800 GCCCCCCAAACAAAAACACAGGG - Intergenic
965501579 3:169462357-169462379 GAGCCCTAAGTAAAAACATCTGG - Intronic
967556976 3:190871510-190871532 GAGTCTGAAACAAAAACTCAAGG + Intronic
968685567 4:1956061-1956083 TAGACCCAAAGAAAAACACAGGG - Exonic
971155816 4:24081855-24081877 GAGCCCTGCACAAAAAGACCGGG - Intergenic
971390527 4:26181178-26181200 GAGCAATAATTAAAAACACACGG - Intronic
971408961 4:26350036-26350058 GAGCACTGAACAAAAAGACAAGG - Intronic
971568200 4:28172670-28172692 GCTCCCTAACCATAAACACATGG - Intergenic
971596566 4:28536573-28536595 GTCCCCTAAACAGAACCACAGGG + Intergenic
973611689 4:52641652-52641674 GAGCCTAAAACAAAAACACAGGG + Intronic
975571884 4:75826290-75826312 GAGCCCTCAACAAAAGGAGAGGG + Intergenic
976023003 4:80653345-80653367 AAGCCCTAAACTACAACAGAGGG - Intronic
980487429 4:133476902-133476924 GAGCCCTTAACATAATCATAGGG - Intergenic
981140075 4:141257909-141257931 GAGCATTAAAAAAAATCACATGG - Intergenic
981626483 4:146762001-146762023 GAGCCCAGAAAAAAAACACAAGG - Intronic
982503000 4:156182530-156182552 GAACACTAAACAAAAACACCTGG - Intergenic
982914605 4:161190339-161190361 GAGACATATACATAAACACATGG + Intergenic
983323204 4:166221419-166221441 GGGCACTTAACAAACACACAAGG - Intergenic
986847952 5:11777824-11777846 GAGAGCTAATAAAAAACACAGGG - Intronic
987636583 5:20550633-20550655 GAGCCCTAATAAGAAACATAAGG + Intronic
987899634 5:23995108-23995130 GAGCGATCAACAGAAACACAGGG - Intronic
988245736 5:28678082-28678104 TAGCCCCAAGCAAAAACAGATGG + Intergenic
989282243 5:39658334-39658356 AAGTCCTAAAAGAAAACACAGGG + Intergenic
989288601 5:39733885-39733907 GTGCCCTAAACAGCAGCACAGGG + Intergenic
989669850 5:43903450-43903472 GAGGATTAAACAAAAATACATGG + Intergenic
992512515 5:77452450-77452472 GAGCCCTGGACTAAAACACAGGG - Intronic
995425557 5:112018407-112018429 TATCCCTAAACAACAACAAAAGG + Intergenic
995587512 5:113663479-113663501 GTGCTCTAGATAAAAACACATGG + Intergenic
996735317 5:126753212-126753234 AAGCAAAAAACAAAAACACAAGG + Intergenic
997238067 5:132286107-132286129 GAGCCTTAAAGTTAAACACATGG + Intronic
997598578 5:135124039-135124061 GAGCCATAAACAAAGACAGGAGG + Intronic
998422585 5:142001270-142001292 GAGGCTTTCACAAAAACACAGGG + Exonic
998891571 5:146751827-146751849 GAGCACAACACAAAAGCACATGG + Intronic
1000167359 5:158665897-158665919 GTGCACTCAACAAATACACATGG + Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1000903110 5:166932483-166932505 AAGCCCCAAACAAACAAACACGG + Intergenic
1001718391 5:173836265-173836287 AAGCCAAAAACAAAAAAACAGGG + Intergenic
1003975713 6:11341998-11342020 GAACCCTAAAAAGAAACAAATGG + Intronic
1005352920 6:24954127-24954149 GAGCCCTAAATAAAATTACCTGG + Intronic
1005421899 6:25660016-25660038 GAGCACAAAAGAAAAAAACAAGG + Intronic
1010384072 6:75258674-75258696 GAGACCAAAACTAAAGCACAAGG + Intronic
1011514127 6:88133968-88133990 GAGCCATAAACCAAAAGACTTGG - Intergenic
1011779647 6:90772610-90772632 GGGCACTAAACAAAAGCATAAGG - Intergenic
1014495131 6:122112021-122112043 GATCCCAAACCACAAACACATGG + Intergenic
1014599959 6:123398977-123398999 GATTCCAAAACAAAAATACATGG - Intronic
1015161104 6:130152824-130152846 GAGGCCTGGACAAAAGCACAGGG + Intronic
1015590781 6:134821070-134821092 GAGCCCCCAACAAAAACCGAGGG + Intergenic
1017337243 6:153275737-153275759 GAGAGCTAAATAATAACACATGG - Intergenic
1020003511 7:4768985-4769007 CAGCCCTGCACAAAAATACAAGG - Exonic
1020208985 7:6143669-6143691 GAGCCCTAACCAGAAACAAAAGG - Intronic
1021556170 7:21920745-21920767 GAGTGCTAAACAACAACAAAAGG - Intronic
1027888017 7:83934794-83934816 GAGGACAAAACAAAATCACATGG + Intergenic
1028495870 7:91460236-91460258 TAGCCTAAAACACAAACACACGG + Intergenic
1030523521 7:110627427-110627449 GAGCACTGAACAAAAGCACCTGG + Intergenic
1033304171 7:140212309-140212331 GCTCCCTAAACATAGACACAGGG + Intergenic
1036812485 8:11877069-11877091 GAGCCCTAAATAAATAAACAAGG - Intergenic
1038092359 8:24268580-24268602 AAGGGCTAAACAAAAAGACAGGG - Intergenic
1039031980 8:33320716-33320738 GAGCTTTAAACCAAAACACATGG + Intergenic
1044634713 8:94310791-94310813 GAACCTTAAAAAAAAAAACAGGG + Intergenic
1045114743 8:98970756-98970778 GAGCATTAAACAGAAACACCAGG - Intergenic
1046138539 8:110061550-110061572 GAGGCCTAAAAAGAAAAACAAGG + Intergenic
1046290822 8:112158187-112158209 GAAACAAAAACAAAAACACATGG + Intergenic
1047859270 8:128946800-128946822 GGCCCCTAAACAAAATCAAATGG + Intergenic
1048826817 8:138435947-138435969 TAGCCCTGATCAAAAAGACAAGG - Intronic
1050202651 9:3162006-3162028 GAGCCCTAAATCTAATCACAAGG - Intergenic
1051159169 9:14186370-14186392 GAGCCTTAAAAAAAATCTCATGG - Intronic
1051367907 9:16334224-16334246 CAGGCCTAAACAAAAATACCTGG + Intergenic
1052742907 9:32410957-32410979 GACCCCAAAAGAAACACACATGG - Intronic
1053193340 9:36093463-36093485 AAGCTCTAAAAAAAACCACATGG + Intronic
1053242046 9:36503990-36504012 GAGCCCTAATCACAACTACAGGG + Intergenic
1055007220 9:71521894-71521916 CAGCCCTCACCAGAAACACATGG + Intergenic
1055403009 9:75944603-75944625 GTGCCCTCAACAAAGACAGAAGG - Intronic
1061648015 9:132022007-132022029 GTGGCCTAAACTAAGACACATGG + Intronic
1061952377 9:133943656-133943678 GTGCCCTAAACAAACACAGTGGG - Intronic
1186930670 X:14385875-14385897 GAGACCTAAAGAGAAAGACAAGG - Intergenic
1188895564 X:35664166-35664188 GAGCCCTAAACCAATATAAATGG + Intergenic
1190681486 X:52830415-52830437 GAGGCATAAAAAAACACACAGGG - Intergenic
1192526788 X:71853079-71853101 GAGACTTAAAAAAAAACAAAAGG + Intergenic
1193261075 X:79406904-79406926 CAGTCCTAAACATAAAAACAAGG + Intergenic
1193836087 X:86345851-86345873 GATCCCTAAATAAAAGAACAGGG + Intronic
1195852608 X:109299244-109299266 AAACACTAAACAAAAACACATGG + Intergenic
1195997581 X:110746462-110746484 GAGCTCTTAACAGAAACATAAGG - Intronic
1200253010 X:154563825-154563847 GAGCCCTAACCCAGAACACCAGG - Intronic
1200264757 X:154640590-154640612 GAGCCCTAACCCAGAACACCAGG + Intergenic
1200467554 Y:3538625-3538647 AAACCCAAAACAAAAAGACATGG + Intergenic