ID: 1104875696

View in Genome Browser
Species Human (GRCh38)
Location 12:132033068-132033090
Sequence CTGTAACCTCAGCTCCTCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8450
Summary {0: 1, 1: 2, 2: 134, 3: 1700, 4: 6613}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104875696_1104875707 27 Left 1104875696 12:132033068-132033090 CCCCCGAGGAGCTGAGGTTACAG 0: 1
1: 2
2: 134
3: 1700
4: 6613
Right 1104875707 12:132033118-132033140 TTGTATTTTTAGTAGAAACGGGG 0: 3229
1: 107794
2: 221738
3: 148056
4: 77067
1104875696_1104875706 26 Left 1104875696 12:132033068-132033090 CCCCCGAGGAGCTGAGGTTACAG 0: 1
1: 2
2: 134
3: 1700
4: 6613
Right 1104875706 12:132033117-132033139 TTTGTATTTTTAGTAGAAACGGG 0: 5507
1: 175085
2: 210457
3: 120902
4: 65033
1104875696_1104875705 25 Left 1104875696 12:132033068-132033090 CCCCCGAGGAGCTGAGGTTACAG 0: 1
1: 2
2: 134
3: 1700
4: 6613
Right 1104875705 12:132033116-132033138 TTTTGTATTTTTAGTAGAAACGG 0: 6652
1: 204514
2: 138631
3: 62119
4: 38307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104875696 Original CRISPR CTGTAACCTCAGCTCCTCGG GGG (reversed) Intronic