ID: 1104876136

View in Genome Browser
Species Human (GRCh38)
Location 12:132036125-132036147
Sequence GAGCATTGTGGAACACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104876127_1104876136 24 Left 1104876127 12:132036078-132036100 CCAGGTTCACACGGAATGTCGTG 0: 1
1: 7
2: 3
3: 7
4: 30
Right 1104876136 12:132036125-132036147 GAGCATTGTGGAACACACCCAGG 0: 1
1: 0
2: 3
3: 14
4: 148
1104876133_1104876136 -9 Left 1104876133 12:132036111-132036133 CCCGGGTTCACACGGAGCATTGT 0: 1
1: 1
2: 1
3: 5
4: 69
Right 1104876136 12:132036125-132036147 GAGCATTGTGGAACACACCCAGG 0: 1
1: 0
2: 3
3: 14
4: 148
1104876134_1104876136 -10 Left 1104876134 12:132036112-132036134 CCGGGTTCACACGGAGCATTGTG 0: 1
1: 2
2: 0
3: 23
4: 103
Right 1104876136 12:132036125-132036147 GAGCATTGTGGAACACACCCAGG 0: 1
1: 0
2: 3
3: 14
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104876136 Original CRISPR GAGCATTGTGGAACACACCC AGG Intronic
902244614 1:15112449-15112471 GAGCGTTTTGGAACGCCCCCTGG + Exonic
905227137 1:36486638-36486660 AAGGCTTGTGGAACACAGCCAGG + Intergenic
906952277 1:50344680-50344702 GAGAATCATGGAAGACACCCTGG + Intergenic
908276820 1:62481887-62481909 AAGCATTGTGGAAAACAACTGGG - Intronic
909181156 1:72425549-72425571 AACCATTGTGGAAGACACTCTGG - Intergenic
909690999 1:78407993-78408015 GAGCATGGTGGCACACATACTGG - Intronic
909702310 1:78540181-78540203 GAGCATGGTGAATCACACACAGG + Intergenic
915449670 1:155995860-155995882 GATCTTTGTGAAACTCACCCTGG + Intronic
918229139 1:182512593-182512615 CAGCACTGTGGCACACACACTGG - Intronic
921154477 1:212428283-212428305 CAGCACAGGGGAACACACCCAGG + Intergenic
923922396 1:238582441-238582463 AATCATGGTGAAACACACCCTGG + Intergenic
924630947 1:245740286-245740308 GACCATTGTGGAAGACAGCATGG + Intergenic
1062910547 10:1209107-1209129 GTGCATTGTGGGAGACACACAGG + Intronic
1068342754 10:55729627-55729649 GAGCTCTGTGGAACTCATCCTGG - Intergenic
1072053752 10:91732375-91732397 GAGCATTGTGGAAGACAGTGTGG - Intergenic
1074524356 10:114251313-114251335 GAGCATTGGGGATGTCACCCAGG + Intronic
1074829409 10:117238360-117238382 GAGCATCGTGGTACACACGTGGG - Intergenic
1075238277 10:120752556-120752578 GACCATTGTGGAAGACAACATGG - Intergenic
1075649307 10:124117233-124117255 AAGCCTTTTGGGACACACCCTGG + Intergenic
1077828342 11:5835183-5835205 GAGCTTTGAGGAACACCCCCCGG + Intronic
1084278115 11:68066770-68066792 GATCACTGTGGAACAAAGCCTGG + Intronic
1084489328 11:69469861-69469883 GGGCATGGTGGCACACACCTGGG - Intergenic
1089164992 11:116468998-116469020 GAGAATTATGGAAGAAACCCTGG - Intergenic
1091338194 11:134789294-134789316 GAGCATTGTGGATCACCACCTGG + Intergenic
1091890905 12:4053589-4053611 GAGCATTGTAGAAATCATCCAGG + Intergenic
1096570673 12:52521294-52521316 GAGCTTGCTGGAACACACCTGGG - Intergenic
1104681129 12:130752712-130752734 GGGCATTGTGGGAAACTCCCTGG + Intergenic
1104876136 12:132036125-132036147 GAGCATTGTGGAACACACCCAGG + Intronic
1106219408 13:27733311-27733333 CAGCCTTGGGGAGCACACCCTGG - Intergenic
1109721430 13:66281210-66281232 AACCATTGTGGAAGACAGCCTGG - Intergenic
1111949081 13:94695718-94695740 GATGATTCTGGTACACACCCAGG - Intergenic
1113317256 13:109194626-109194648 GATATATGTGGAACACACCCTGG - Intronic
1113794200 13:113047487-113047509 GAGCATTGTGGGACCCGCCCAGG - Intronic
1114690227 14:24574213-24574235 GGGCATTGGCCAACACACCCCGG - Intronic
1115740576 14:36383250-36383272 GAGCATTGTGATACTCACTCTGG + Intergenic
1116261632 14:42635807-42635829 GATGATTGTGGAAAACAACCTGG - Intergenic
1116261645 14:42635900-42635922 GATGATTGTGGAAAACAACCTGG - Intergenic
1117865888 14:60148780-60148802 GAGCATTTTGACACACACACTGG + Intronic
1118127721 14:62927305-62927327 AAGCACTGTGGAACACACTGTGG + Intronic
1119886511 14:78147923-78147945 AAGCAGTGTGGAATACACACTGG - Intergenic
1120470634 14:84919326-84919348 CAGCATTGTGCAATATACCCAGG - Intergenic
1120713340 14:87815621-87815643 TAGCATCCTGGAAGACACCCAGG - Intergenic
1120722057 14:87900379-87900401 GAGCTGTGTTGAACACACACAGG + Intronic
1121505373 14:94473085-94473107 GAGCAATGAGGAACACAGACAGG - Intronic
1121796168 14:96737200-96737222 GTTCATTGTGGAAGACACACTGG - Intergenic
1123823306 15:24054815-24054837 GAACCTTGTGGAAAACATCCAGG + Intergenic
1126198505 15:45957962-45957984 GACCATTGTGGAAGACAGTCGGG + Intergenic
1128233755 15:66053235-66053257 AAGCATTGTGGAAAACACAAAGG - Intronic
1130090649 15:80818277-80818299 GAGCATGGTGGATCATACACTGG + Intronic
1130373799 15:83310111-83310133 GTGCCTTGTGGAACACACCCTGG + Intergenic
1130642022 15:85685757-85685779 GGGCACGGTGGATCACACCCAGG - Intronic
1137762299 16:50950492-50950514 GAGCATTGTGGGACCCTCCAAGG + Intergenic
1139601617 16:67990853-67990875 GAGCACTGTTGCACACACCCCGG + Exonic
1141049037 16:80744212-80744234 GAGCCCTGGGGAACACACGCTGG + Intronic
1143860888 17:9889929-9889951 GGGCATTGTGGAAAACACACTGG - Exonic
1144513264 17:15895811-15895833 GAGGACTGAGGAACACACCTGGG + Intergenic
1144601816 17:16622559-16622581 GTGCATTGGAGAACACACACTGG - Exonic
1144823307 17:18090539-18090561 GGGCGTTGTGGCACACACCTGGG - Intronic
1146249493 17:31326192-31326214 GAGCATTGTGGAATACCTTCAGG - Exonic
1147978672 17:44261850-44261872 GAGCCTTGTCGAGGACACCCGGG + Intronic
1153988121 18:10371130-10371152 GAGCATAGAGGCACACTCCCAGG + Intergenic
1156175140 18:34535064-34535086 AACCATTGTGGAACACACTGTGG - Intronic
1157070825 18:44405707-44405729 AAGCATTGTTGAACACACTAGGG + Intergenic
1157276304 18:46313324-46313346 GAGATTTCTGGAACACAGCCTGG - Intergenic
1159234098 18:65648695-65648717 GACCATTGTGGAAAACAGGCTGG + Intergenic
1159777469 18:72620111-72620133 GAGCATTGTGGCACACCCTCTGG - Intronic
1160865703 19:1255015-1255037 GAGCTTTGTGAATCACGCCCCGG + Exonic
1162482308 19:10935232-10935254 GATCTTCCTGGAACACACCCTGG - Intergenic
1164471619 19:28541159-28541181 GAGCAGAGTGGGAGACACCCTGG + Intergenic
1165262873 19:34635963-34635985 GAGCATCAGGGAATACACCCCGG - Intronic
1166948393 19:46411308-46411330 GAGCCTTCTGGCACACTCCCCGG - Exonic
925013111 2:500761-500783 GAACATAATGGAAAACACCCTGG + Intergenic
925734993 2:6956174-6956196 GAGGATTGTGTCAGACACCCAGG + Intronic
925906350 2:8541870-8541892 GAGCCTCGTGCAAAACACCCCGG + Intergenic
926556056 2:14359415-14359437 GAACATTGTGGAAAACACTATGG + Intergenic
928451604 2:31383102-31383124 GAGCATTGTGGAAAAAACCCTGG - Exonic
932235141 2:70114961-70114983 GGGCATGGTGGTACACACCTAGG - Intergenic
932275713 2:70450890-70450912 AAGCACTGTGGGCCACACCCTGG + Intronic
934549581 2:95248435-95248457 CAGCATCATGGAACATACCCAGG + Intronic
934793446 2:97082109-97082131 CAGCTTTTTGAAACACACCCTGG - Intergenic
935099151 2:99976045-99976067 GAGCATTGTAGAAAAAACCTGGG - Intronic
936274487 2:111082592-111082614 AACCATTGTGGAAGACACCGTGG + Intronic
939521618 2:143238612-143238634 GATCATTGTGGAAGACACTGTGG + Intronic
939613920 2:144341113-144341135 TAGCATTGTGGAACCTATCCTGG + Intergenic
940473341 2:154128091-154128113 GAACATTGTCAAACATACCCTGG - Intronic
942793137 2:179783891-179783913 AACCATTGTGGAACACAGCATGG + Intronic
946168923 2:217882251-217882273 GATCACTGTGGAACAGACCAGGG + Intronic
946565133 2:220956083-220956105 GAGCTGTGAGGAACACACCCAGG - Intergenic
948350471 2:237336060-237336082 AGGCTTTGAGGAACACACCCTGG + Intronic
1168844925 20:937841-937863 AACCATTGTGGAAGACACCGTGG - Intergenic
1169334937 20:4748421-4748443 GAGCACTGTGCCACCCACCCTGG + Intergenic
1173076590 20:39825117-39825139 GAGCACTGTGAAACACACAGAGG + Intergenic
1173292544 20:41727274-41727296 CAGCTGTGTGGAACACAGCCTGG - Intergenic
1176088247 20:63307681-63307703 GAGCTGTGGGGACCACACCCGGG - Intronic
1180916346 22:19490966-19490988 GGGCATGGTGGCACACACCTGGG - Intronic
1181090836 22:20471442-20471464 TAGCATTGTAGGACACACCGTGG + Exonic
1183670702 22:39270713-39270735 CAGCATTGGGGAACACTCTCTGG + Intergenic
1183935157 22:41257812-41257834 GAGCCATGGGGCACACACCCAGG + Intronic
1185177923 22:49340646-49340668 GAGCATGGCAGAGCACACCCAGG + Intergenic
950684523 3:14606995-14607017 GTGCAGTGGGGAACACACCCTGG - Intergenic
953800743 3:46020846-46020868 GAGCATTGCAGAACACAGCAGGG - Exonic
957853206 3:85838421-85838443 GAGCCTTGTGCAACCCACCTTGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961497374 3:127304484-127304506 GAGCTTTGTGTATCGCACCCGGG - Intergenic
963654990 3:148036432-148036454 AACCACTGTGGAACACACACCGG - Intergenic
964686833 3:159404675-159404697 CAGCATCTTGGAACCCACCCAGG + Intronic
965123600 3:164595413-164595435 GAGCATTGTAACACACACTCTGG - Intergenic
969662396 4:8537924-8537946 GGTCATTGTGGATCAGACCCCGG + Intergenic
970287058 4:14529739-14529761 GAGCCTTGTGAAAAACACCCAGG + Intergenic
972044212 4:34642835-34642857 CAGCATTATGAAACATACCCAGG + Intergenic
974715636 4:65667580-65667602 GAATCTTGTGGAACACAGCCTGG - Intronic
977262477 4:94814475-94814497 GTGGGTTGTGGAACACATCCTGG + Intronic
977731929 4:100363976-100363998 GGGCATTGTGGAACACTCACAGG - Intergenic
977925034 4:102690880-102690902 CAGCATTGTGGAGCACATACTGG - Intronic
982460735 4:155666872-155666894 GAGCAGCCTGGAACAGACCCAGG + Intronic
983416696 4:167465583-167465605 GAGGGTTGTGGGACACACCCTGG - Intergenic
985620272 5:951358-951380 AATCATTGTGGAGCACAGCCAGG - Intergenic
987098803 5:14574451-14574473 AAGCATTGTGCAGAACACCCAGG + Intergenic
994728023 5:103459431-103459453 GAGCTTCGTGAAACACACGCTGG + Intergenic
995209639 5:109522825-109522847 CAGCATTATGCAACATACCCAGG - Intergenic
997674299 5:135701215-135701237 GAGCAGGGTGGTACACAGCCTGG - Intergenic
999000264 5:147913265-147913287 CAGCAATGTGGAAGACAGCCTGG - Intergenic
999799146 5:155017246-155017268 GGGCACTGTTGAACAGACCCAGG + Exonic
1001200766 5:169714179-169714201 GAGCTTTGTGGAGCACACCAGGG - Exonic
1001804794 5:174574190-174574212 GAGCTTTGTGGATCACACAGAGG + Intergenic
1010125114 6:72422290-72422312 GAGCTATGTGAAACTCACCCAGG - Intergenic
1013178576 6:107698923-107698945 GAGCAATGTGGAACCCACGGGGG + Intergenic
1015028025 6:128560800-128560822 GAGCATTGTGATAAAAACCCAGG + Intergenic
1018616980 6:165695915-165695937 GGGCACTGTTGAAAACACCCAGG + Intronic
1018738386 6:166707447-166707469 GAGCAGTGAGGAACAAAACCAGG + Intronic
1018937417 6:168282943-168282965 GAGCACTGTGGGACACACAGAGG + Intergenic
1020694598 7:11397969-11397991 AACCATTGTGGAACACAGCATGG + Intronic
1022740625 7:33117113-33117135 GAACATTGGGGAACATACCTAGG - Intergenic
1023152087 7:37211718-37211740 GACCACTGTGGAATACAGCCAGG - Intronic
1023686545 7:42741161-42741183 GAGCATTGTGTCCCACACCCAGG - Intergenic
1024564873 7:50672890-50672912 GAGCAAAGTTGAACAAACCCTGG + Intronic
1026342350 7:69445339-69445361 GTGCACTGTGAAACACACACGGG - Intergenic
1026425348 7:70286380-70286402 GAGTATGGTGGTACACACGCAGG - Intronic
1029246426 7:99205284-99205306 GGGCATGGTGGTACACACCATGG + Intronic
1031097082 7:117433317-117433339 GACCATTGTGGAAGACACTGTGG + Intergenic
1033505838 7:141998828-141998850 AAGCATTGTGGAAGACAGCGTGG - Intronic
1033570441 7:142623139-142623161 GAGCCTAGTTGACCACACCCGGG - Intergenic
1035086442 7:156263164-156263186 AAGCATTGTGGAAGACAGCGTGG - Intergenic
1035299157 7:157885914-157885936 GTGAAGTGTGGAACACACCCCGG + Intronic
1035610793 8:962690-962712 GAGCAGAGTGGAACCCTCCCTGG + Intergenic
1035770639 8:2143914-2143936 GGTCATTGTGGAACACATCGTGG + Intronic
1037733666 8:21549847-21549869 GAGGAGTGTGGAACGAACCCTGG - Intergenic
1040900035 8:52409372-52409394 GAGCATTTTGGAACACATCCAGG - Exonic
1045478257 8:102571808-102571830 GGGTATGGTGGAACATACCCCGG + Intergenic
1045582006 8:103492299-103492321 AACCATTGTGGAAGACACCATGG + Intergenic
1046475562 8:114738294-114738316 AACCATTGTGGAAGACACCTTGG + Intergenic
1050608927 9:7330914-7330936 AAGCAGTGTAGAACACACCTTGG - Intergenic
1051575718 9:18613281-18613303 AAGCATTGTGGAAGACAACATGG + Intronic
1055284682 9:74715821-74715843 GAACATGGAGGAACACACACGGG - Intergenic
1060996475 9:127877165-127877187 GTGCATTGGAGAACACCCCCTGG - Intronic
1062363335 9:136197675-136197697 GAGCTTGGGGGAACCCACCCAGG - Exonic
1062414392 9:136440363-136440385 GAACATTTTGGAAAACATCCTGG + Exonic
1185867251 X:3634828-3634850 GAGCATGATGGTACACGCCCAGG - Intronic
1189443593 X:41059914-41059936 AAGCAATGTGGAACACACAAAGG + Intergenic
1189443921 X:41063092-41063114 AAGCAATGTGGAACACACAAAGG + Intergenic
1190821192 X:53974477-53974499 AAGCATTGTGGAAGACAGCATGG + Intronic
1192693853 X:73393620-73393642 AATCATTGTGGAACACACTGTGG - Intergenic
1194894628 X:99425476-99425498 GAGCATGGTGGCATACACCATGG + Intergenic
1195887738 X:109657789-109657811 GACCATTGTGGAAGACACTGTGG - Intronic
1201783268 Y:17745739-17745761 GGCCATTTTGGAACACCCCCAGG - Intergenic
1201818285 Y:18160248-18160270 GGCCATTTTGGAACACCCCCAGG + Intergenic