ID: 1104877072

View in Genome Browser
Species Human (GRCh38)
Location 12:132042735-132042757
Sequence CTGTTTCAGCAGATGAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104877070_1104877072 13 Left 1104877070 12:132042699-132042721 CCACATCTGCTAGTAACTATAGA 0: 1
1: 0
2: 2
3: 5
4: 94
Right 1104877072 12:132042735-132042757 CTGTTTCAGCAGATGAACAGTGG 0: 1
1: 0
2: 1
3: 17
4: 175
1104877069_1104877072 14 Left 1104877069 12:132042698-132042720 CCCACATCTGCTAGTAACTATAG 0: 1
1: 0
2: 1
3: 4
4: 69
Right 1104877072 12:132042735-132042757 CTGTTTCAGCAGATGAACAGTGG 0: 1
1: 0
2: 1
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104877072 Original CRISPR CTGTTTCAGCAGATGAACAG TGG Intronic
900426539 1:2582764-2582786 CGGTTTCAGCATATGAACTGGGG - Intergenic
900524030 1:3119830-3119852 CTGTGTCAGCTGCTGAGCAGGGG - Intronic
900536307 1:3179408-3179430 CTGTTTCCCCAGCTGTACAGTGG + Intronic
901702410 1:11052782-11052804 CTGTTTCAGCAGATCATCCTGGG + Intergenic
905707511 1:40072383-40072405 CTGTCTAAGCACCTGAACAGAGG + Exonic
905942405 1:41874598-41874620 CTGTTTCAGTATCTGAGCAGCGG + Intronic
907336713 1:53704517-53704539 CTGGGTGAGCAGATGAACAGTGG + Intronic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
908276665 1:62480378-62480400 CTATTACTGAAGATGAACAGTGG - Intronic
913529257 1:119721892-119721914 CTGTTTCTGCAGAAACACAGGGG + Intronic
914424699 1:147564776-147564798 CTGTTTCAACAGAAGAATAAAGG - Intronic
915085351 1:153384411-153384433 CTCTGCCAGCAGATGATCAGAGG + Intergenic
915194008 1:154175551-154175573 CTGATTCAGCAGATCAGCATAGG + Intronic
918430635 1:184456556-184456578 CTGTTTCTAAAGAGGAACAGTGG - Intronic
918474785 1:184912534-184912556 CTGTTTCAACAGGTGAAAAATGG + Intronic
919530783 1:198717222-198717244 ATGTTTTATCAGATGAACAGAGG - Intronic
919568805 1:199221097-199221119 CTGTTTCAACTTATGCACAGGGG + Intergenic
919644388 1:200079399-200079421 CTCTGTCGGAAGATGAACAGGGG + Intronic
923714337 1:236412098-236412120 CTGGGTCAGCAGGTGAGCAGTGG - Intronic
924714777 1:246563138-246563160 CTGTGTCAGCTGTTGAACAGTGG - Intronic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1063253884 10:4304875-4304897 CGGTTTCAGCATATGAACTTGGG + Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1065207271 10:23369168-23369190 GTCTTTGAGCAGATGAACAGGGG - Intergenic
1066365405 10:34771326-34771348 CTGTTACCTCAGATGAAGAGGGG - Intronic
1066539053 10:36424523-36424545 CTGTTTCTGCAAATGAAATGTGG - Intergenic
1066555813 10:36611810-36611832 TTATTTCAGCAGAGAAACAGAGG - Intergenic
1069814138 10:71182862-71182884 CAGTTTCAACAGATGAACAGGGG + Intergenic
1072785054 10:98273610-98273632 CTGTCTCAGCAGCTGGACACAGG + Intergenic
1073839485 10:107482152-107482174 CTGTCTTTGCAGATGAACGGAGG - Intergenic
1074520052 10:114211857-114211879 CTTTTTCAGAGGATGATCAGTGG + Exonic
1074597804 10:114883286-114883308 CTGATTCAGGGGATGAAGAGTGG + Intronic
1080176879 11:29374274-29374296 CTGTGTAAGCTGAAGAACAGTGG - Intergenic
1082984885 11:59159994-59160016 CTGTTTCAGCCAATTTACAGGGG + Intergenic
1086274563 11:85110494-85110516 ATTTTTGAGCAGATGATCAGAGG - Intronic
1086783310 11:90934122-90934144 TTGTTTCAGCACATGTAAAGTGG - Intergenic
1087194809 11:95294639-95294661 CTGTTACAGAAGAAGAGCAGAGG + Intergenic
1089281231 11:117376020-117376042 CTCATTCAGCAGCTGAAGAGTGG + Intronic
1089580139 11:119476553-119476575 CAGGTTCTGCAAATGAACAGAGG + Intergenic
1093200881 12:16184969-16184991 CTGTTTCAGATGAGAAACAGAGG + Intergenic
1093407622 12:18824390-18824412 CTGTTGGAGAAAATGAACAGTGG - Intergenic
1094288441 12:28819103-28819125 CTGTCTTTGCAGATGGACAGAGG + Intergenic
1097399486 12:59111984-59112006 CAGTTTCAGCACATGAACTTTGG - Intergenic
1098788555 12:74790913-74790935 CTGTCTCAACAGAAAAACAGTGG + Intergenic
1102783233 12:115583674-115583696 GTGTTTCAGCAGAAGGAAAGTGG - Intergenic
1104877072 12:132042735-132042757 CTGTTTCAGCAGATGAACAGTGG + Intronic
1107675009 13:42786577-42786599 CTGTTTAAGCAAATGAAGAGAGG + Intronic
1108434954 13:50392685-50392707 TTATATCAGCAGATGAATAGAGG + Intronic
1109252670 13:60039202-60039224 CAGTTTCAGAAGTTGAAGAGTGG + Intronic
1112392215 13:98995909-98995931 CTCTTTGAGCAGCTGAACAGTGG + Intronic
1113280342 13:108781593-108781615 CTGTCTTTGGAGATGAACAGAGG - Intronic
1114185069 14:20394814-20394836 CTGAATCAGTAGCTGAACAGAGG - Intronic
1114931930 14:27482271-27482293 CAGTTTCAGCAAAAGCACAGAGG + Intergenic
1117366058 14:55028356-55028378 CTCTTTCGGGAGATCAACAGTGG - Intronic
1122313643 14:100813005-100813027 CTCTTTGAGCAAATGAAAAGGGG + Intergenic
1123974311 15:25538313-25538335 CAGTTTCATGAGATGAACATGGG + Intergenic
1124887979 15:33704723-33704745 CTGTTTCAAAAGATGAACTGAGG - Intronic
1125564672 15:40667588-40667610 CTGTTTCAGAAGAGGAAGAGAGG + Intergenic
1128540414 15:68524859-68524881 ATGTTGCAGCAGCTGATCAGAGG + Intergenic
1133983104 16:10648155-10648177 CTGTGTAAGCAGAGGAACAAGGG + Intronic
1135170890 16:20182436-20182458 CTGTTTCTTCAGATGTACAATGG - Intergenic
1137338105 16:47571519-47571541 GTGTTCCTGCAGATGGACAGAGG - Intronic
1137390052 16:48073870-48073892 GTGTGACAGCAGATGAAAAGTGG - Intergenic
1138327733 16:56190402-56190424 ATGTTTCAGAAGATGAAAAAAGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1144724586 17:17495534-17495556 TTGTTGCCGCAGATGACCAGGGG + Exonic
1147247701 17:39132923-39132945 CTGTGATACCAGATGAACAGAGG + Intronic
1148664741 17:49365902-49365924 CAGTGTCAGCAGCTGAACAAGGG - Intergenic
1152215067 17:79027267-79027289 CAATTTCAGCAGGTTAACAGGGG - Intronic
1155001104 18:21687512-21687534 CTGTTACAGAAGTTTAACAGAGG - Intronic
1155361960 18:25011950-25011972 CTGCTTCAGCATATGAAAACGGG + Intergenic
1155745815 18:29355638-29355660 CTGGGCCAGCAGATGCACAGAGG + Intergenic
1157028446 18:43875587-43875609 CTTTTTCAGCTGATGAGCAAGGG + Intergenic
1157121229 18:44913124-44913146 CTGATCCAGCAGATTACCAGGGG + Intronic
1157597348 18:48871769-48871791 CATTTTCAGCAGATGAACCGAGG - Intergenic
1158181830 18:54724844-54724866 CTTTTTCAAAGGATGAACAGAGG + Intronic
1158726651 18:59979641-59979663 ATGTTCCAGCAGATGCATAGCGG - Intergenic
1159086470 18:63797938-63797960 CTGCTTTAGCTGAAGAACAGTGG - Intronic
1164529207 19:29035240-29035262 CTGTTTCCTCAGAAGCACAGAGG - Intergenic
1164766179 19:30773252-30773274 CAGTTTCAGGAAGTGAACAGTGG - Intergenic
1166425419 19:42674049-42674071 CTGTTTTTTCAGATGTACAGTGG + Intronic
925293753 2:2764802-2764824 ATGTTTCGACACATGAACAGTGG + Intergenic
925660972 2:6202144-6202166 AGGTTTCAACATATGAACAGGGG + Intergenic
926389623 2:12375268-12375290 GTGTTTCAGGAGATGAGCATTGG + Intergenic
926909068 2:17832883-17832905 TTTTTTCTGCAGATAAACAGAGG + Intergenic
928132677 2:28664462-28664484 CCGTCTTTGCAGATGAACAGAGG + Intergenic
928569507 2:32589737-32589759 ATGTTTCAGCAGTTTACCAGGGG - Intronic
931041735 2:58308655-58308677 CTGTTTCAGGGGAGGAACAATGG - Intergenic
935526103 2:104169659-104169681 CTATTCCAGTATATGAACAGTGG + Intergenic
935876873 2:107517019-107517041 CTGTTTCAGCAAATGTATAGTGG + Intergenic
936759755 2:115762454-115762476 GTGTTTCACCAGTTGAAGAGAGG + Intronic
937380670 2:121373826-121373848 GTGTTTATGCAAATGAACAGAGG - Intronic
937707135 2:124934102-124934124 CTGTTTCAAAACAGGAACAGTGG - Intergenic
938920679 2:135991953-135991975 CTGATTCAGCTGGTAAACAGGGG - Intergenic
939249638 2:139667336-139667358 CTGATTCAGCAGAGGGAGAGAGG - Intergenic
939469628 2:142603743-142603765 CTGTTTTATTAGATGAACAGGGG + Intergenic
939488747 2:142850953-142850975 TTGTTCAAGCAGATGAACATAGG - Intergenic
939529583 2:143340755-143340777 GGGTTTCATCATATGAACAGAGG - Intronic
942070930 2:172314671-172314693 ATTTTTCACCAGTTGAACAGTGG + Intergenic
947095343 2:226560855-226560877 TTGTGTCTGCAGTTGAACAGAGG - Intergenic
948215849 2:236230110-236230132 CTGTTTGAGAAGATAAAAAGGGG + Intronic
1169519382 20:6354757-6354779 CTGTTTCTGAAGAGGAAAAGGGG + Intergenic
1169583685 20:7056694-7056716 ATATTTCAGAGGATGAACAGAGG - Intergenic
1169597005 20:7211912-7211934 CTAATTCACCAGATGACCAGAGG - Intergenic
1170593976 20:17791889-17791911 CTGATTCAGTAGATCAGCAGTGG + Intergenic
1172863130 20:38072627-38072649 GTGTTTCAGCTCATGAACAGGGG + Intronic
1174473586 20:50779723-50779745 TTGTTTCAGCAAATCAACTGTGG + Intergenic
1175024193 20:55884167-55884189 CTGTTTCAGTACATGTATAGAGG + Intergenic
1183277036 22:36905144-36905166 GGGTTTCTGCAGAGGAACAGGGG + Intergenic
1183531448 22:38356050-38356072 CTGTGTCAGCTGTTGAACAGTGG + Intronic
949574579 3:5326498-5326520 TTTTTTCAGCAAATGAACACAGG + Intergenic
949694749 3:6681383-6681405 CTGGTTCAGCAGACGAAGGGTGG + Intergenic
952329517 3:32351128-32351150 CTGACACAGCAGATGAACATGGG + Intronic
953572732 3:44084386-44084408 ATGATTTAGCAGAAGAACAGAGG + Intergenic
956924072 3:73963528-73963550 CTGATTAAGCAGTTGGACAGTGG + Intergenic
957775968 3:84757359-84757381 CTGAGCCTGCAGATGAACAGGGG + Intergenic
959680449 3:109090175-109090197 ATGTTCAAGCACATGAACAGTGG - Intronic
960900055 3:122545229-122545251 CAGTTTCATGATATGAACAGAGG - Intronic
961093561 3:124136320-124136342 CTGATTCAGCAGGTCTACAGTGG + Intronic
961504022 3:127358271-127358293 CAGTGCCAGCAGAGGAACAGAGG - Intergenic
963210678 3:142686294-142686316 CTGATTAAGCAGATGAAAATAGG - Exonic
967758139 3:193193485-193193507 CAGCTTCAGCAGAGGAACAGAGG - Intergenic
968832114 4:2937870-2937892 CTGTTCCAGCAGAGGGACTGTGG + Intergenic
969197943 4:5577967-5577989 CTGTGTCATCAGAGGAACGGTGG + Intronic
970899068 4:21137628-21137650 CCTGTTGAGCAGATGAACAGAGG - Intronic
971340951 4:25768391-25768413 ATCTTTCAACAGATGAAAAGTGG - Intronic
972932051 4:44083973-44083995 TAGTTTCAGCTAATGAACAGAGG + Intergenic
973264519 4:48198140-48198162 CTGGTTCTTCAGATGAAAAGTGG - Intronic
974323342 4:60381117-60381139 CTGTTTCAGAATATGTACATAGG + Intergenic
975507773 4:75158145-75158167 CTGCTTCAAAAGATCAACAGGGG - Intergenic
976540918 4:86274698-86274720 CTGATTAGGCAGAGGAACAGAGG + Intronic
978094500 4:104759041-104759063 CTGTTTCAGGAGAAAAACAAAGG - Intergenic
978356221 4:107877745-107877767 CTACTTTAGCAGATGAACAAAGG - Intronic
979779016 4:124625802-124625824 CTGCTGCAGGAGATGAAGAGTGG + Intergenic
983607015 4:169598600-169598622 CTGTTAAAGCAAATGAAAAGAGG + Intronic
983631607 4:169855075-169855097 CTGATTCAGTACATGTACAGTGG + Intergenic
984005518 4:174301817-174301839 TTTTTTGAGCAGACGAACAGTGG + Intronic
985552015 5:538515-538537 GGGTTTCAGGAGATGCACAGAGG + Intergenic
985968742 5:3358157-3358179 ATTTTTCAGCAAAGGAACAGAGG - Intergenic
986495787 5:8340353-8340375 CTGTTTCAGCAGAGCAGCTGAGG - Intergenic
988235584 5:28539623-28539645 CTGTTTCAACTCATGATCAGTGG + Intergenic
989767688 5:45105933-45105955 CTTTTTTAGCAGGAGAACAGGGG - Intergenic
990086390 5:51983403-51983425 CTGTCTCTGCATATGTACAGAGG - Intergenic
991624269 5:68583010-68583032 CTGTTTCAGAATATGAGCAAGGG + Intergenic
993938552 5:94031960-94031982 CTGTCTCTGCAGATGTGCAGAGG + Intronic
996249463 5:121311048-121311070 CTGTTTCAGGAGAAGTACAAAGG + Intergenic
996272686 5:121626701-121626723 CCATTTTAGCAGATGAACACAGG - Intergenic
996364619 5:122687960-122687982 CTCTTTCAGCCTATGAACATGGG - Intergenic
996566165 5:124881469-124881491 CTGTTTCACCAGCTGCACACTGG + Intergenic
997877316 5:137560822-137560844 AGGTTTCAGCATATGAACTGGGG + Intronic
998642127 5:144022886-144022908 AGGTTTCAGCAGATGAATTGTGG - Intergenic
999139476 5:149348672-149348694 ATGTTTCAGCAGATTAAAGGAGG + Intronic
1000266035 5:159639091-159639113 CTGTTTCATCAGCTCAACAATGG + Intergenic
1007327853 6:41075568-41075590 ATATTTCAGCATGTGAACAGTGG - Intronic
1007376977 6:41463575-41463597 CTGAGTGGGCAGATGAACAGAGG + Intergenic
1015822986 6:137282719-137282741 CTGTTGCACCAGATGATCTGGGG + Intergenic
1017491849 6:154952070-154952092 ATGCTTCACCAGAAGAACAGGGG - Intronic
1020926982 7:14340942-14340964 CCTTTTCTGCAGATGAACAAAGG - Intronic
1023413588 7:39911109-39911131 ATTTTTTTGCAGATGAACAGAGG + Intergenic
1024267495 7:47618144-47618166 AGGTTTCAGCATATGAACTGGGG - Intergenic
1027779454 7:82503980-82504002 CTGCTGCAGCAGAGGAAGAGAGG - Intergenic
1028890768 7:95986221-95986243 CAGTTGAAGCAAATGAACAGAGG + Intronic
1030137393 7:106268463-106268485 CTGTTCCAGCAGCAGAACACAGG - Exonic
1030772001 7:113486671-113486693 CTATTTCAGCAGATGTAGAGAGG + Intergenic
1033767918 7:144514899-144514921 CTCTTGCAGCTGATGAACACTGG + Intronic
1035117502 7:156537044-156537066 TTATTCCATCAGATGAACAGTGG + Intergenic
1036039899 8:5065043-5065065 CTGATTCATCTGATGAACTGGGG + Intergenic
1037344632 8:17885768-17885790 CTGTTTCATCACAAAAACAGAGG + Intronic
1039273278 8:35906676-35906698 CTGTCTTTGCAGATGGACAGAGG - Intergenic
1042357242 8:67841645-67841667 CTGCTTCACCAGAAGAATAGAGG + Intergenic
1042944516 8:74141885-74141907 CTGGTTCAGCAGATGAGGACTGG - Intergenic
1043561532 8:81499551-81499573 CTGTTACAGCAGATGAGTTGGGG + Intergenic
1044725345 8:95190406-95190428 CTGGTACAGAAGATGAACAAAGG + Intergenic
1046675915 8:117108460-117108482 CTGTTTTAGCAGGTGCTCAGAGG + Intronic
1047073692 8:121376375-121376397 ATGATTCAGCACCTGAACAGGGG - Intergenic
1050321810 9:4459972-4459994 CTGTTTCAGTAGAATAATAGAGG + Intergenic
1052848936 9:33364001-33364023 CTCTTTCAGGAGATTAGCAGAGG + Exonic
1055082732 9:72282986-72283008 CTCTTTCAGGAGAGGAATAGTGG + Intergenic
1056233177 9:84567476-84567498 TTGTTTCAGCAGAGGTGCAGGGG - Intergenic
1057286239 9:93756888-93756910 ACGTTTCTGCAGATGAAAAGAGG - Intergenic
1058128022 9:101219015-101219037 CTGAGTCAGCAGAGGAACAGAGG + Intronic
1059833995 9:118129442-118129464 TTCTTTCAGCAGAGGCACAGGGG + Intergenic
1188162599 X:26821473-26821495 CTGTTTCAGCTTAGGTACAGGGG + Intergenic
1188386427 X:29565075-29565097 CTTTTTCAGTAAATGAAAAGAGG - Intronic
1190102065 X:47529401-47529423 GGGTTTCAGCAGGAGAACAGGGG + Intergenic
1193360457 X:80573712-80573734 CTGTTTGAGAAGGTGATCAGTGG - Intergenic
1193693692 X:84680539-84680561 CTGTTTCAGCTTAGGCACAGAGG + Intergenic
1194916334 X:99713899-99713921 CTGTTTCATCAGTGTAACAGAGG + Intergenic
1195046113 X:101056099-101056121 CTGTTTCAGCTCCTGAATAGCGG - Intergenic
1196578104 X:117345031-117345053 CTGTTTATGCAGATCAACAATGG + Intergenic
1196594772 X:117532516-117532538 CTGTTTCAGTAAAAGAAAAGGGG - Intergenic
1197155260 X:123263460-123263482 CTTTCTCAGCAGTAGAACAGAGG + Intronic
1197569563 X:128132052-128132074 CTGTTCCTGCAGAGCAACAGGGG + Intergenic
1197654572 X:129102621-129102643 CTATTTCAGAATATGCACAGTGG - Intergenic