ID: 1104877246

View in Genome Browser
Species Human (GRCh38)
Location 12:132044168-132044190
Sequence GTCATCACTGCGTCCTGACG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 69}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104877246_1104877255 26 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877255 12:132044217-132044239 ACCTGAAGACCCTGCAGGAGAGG 0: 1
1: 0
2: 2
3: 19
4: 242
1104877246_1104877257 27 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877257 12:132044218-132044240 CCTGAAGACCCTGCAGGAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 381
1104877246_1104877254 21 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877254 12:132044212-132044234 CTGGAACCTGAAGACCCTGCAGG 0: 1
1: 0
2: 0
3: 27
4: 247
1104877246_1104877252 -6 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877252 12:132044185-132044207 GATGACTGCAGTGAGGGCATGGG 0: 1
1: 0
2: 0
3: 17
4: 188
1104877246_1104877258 30 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877258 12:132044221-132044243 GAAGACCCTGCAGGAGAGGGAGG 0: 1
1: 0
2: 7
3: 55
4: 459
1104877246_1104877253 2 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877253 12:132044193-132044215 CAGTGAGGGCATGGGAGTTCTGG 0: 1
1: 0
2: 2
3: 28
4: 259
1104877246_1104877251 -7 Left 1104877246 12:132044168-132044190 CCCCGTCAGGACGCAGTGATGAC 0: 1
1: 0
2: 0
3: 2
4: 69
Right 1104877251 12:132044184-132044206 TGATGACTGCAGTGAGGGCATGG 0: 1
1: 0
2: 3
3: 31
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104877246 Original CRISPR GTCATCACTGCGTCCTGACG GGG (reversed) Exonic
909896833 1:81081850-81081872 TTTCTCACTGCGTCCTCACGTGG + Intergenic
915647502 1:157284231-157284253 GGCAACACTGCGTCCTCACATGG + Intergenic
1076779636 10:132717138-132717160 CTTCTCACTGCGTCCTCACGTGG + Intronic
1079519117 11:21303907-21303929 ATAATCACTGCGTCCTCACATGG + Intronic
1080560938 11:33461909-33461931 TTCAGCACTGTGTCCTGATGAGG - Intergenic
1091212545 11:133874490-133874512 GCCAACACTGAGTCCTGATGTGG + Intergenic
1091234616 11:134012793-134012815 GTCTTCACTGCCTCCTAAAGGGG + Intergenic
1099122276 12:78706174-78706196 CTTATCACTGTGTCCTTACGTGG + Intergenic
1104877246 12:132044168-132044190 GTCATCACTGCGTCCTGACGGGG - Exonic
1105857665 13:24386828-24386850 CTCCTCACTGTGTCCTCACGTGG - Intergenic
1115568942 14:34649116-34649138 GTCATCTCTGCGTCCTAAAATGG - Intergenic
1123085196 14:105714024-105714046 CTTTTCACTGCGTCCTCACGTGG + Intergenic
1126507246 15:49419404-49419426 GTCATAAATGCTTCCTGACTAGG - Intronic
1134768371 16:16782354-16782376 CTTATCACTGTGTCCTCACGTGG - Intergenic
1139340481 16:66264920-66264942 GGCCTCACTGCTTCCTGACTGGG + Intergenic
1141922315 16:87144231-87144253 GCCACCACTGCATCCTGACCTGG + Intronic
1144838754 17:18172690-18172712 GTCCTCACTGTGTCCTCACATGG + Intronic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1146706927 17:35007487-35007509 GTCATCACTGGGTGCTGAACAGG + Exonic
1148150643 17:45394914-45394936 GTCATCCCTGAGGCCTGAGGAGG + Exonic
1150124501 17:62627667-62627689 GGCATCACTTCGTCCCGACCCGG + Exonic
1153817166 18:8800545-8800567 GTCATGACTGCGAGCTCACGTGG - Intronic
1160325650 18:77945125-77945147 GTCATCACAGGGTCCTAATGGGG - Intergenic
1160483783 18:79269193-79269215 GTCCTCACTGTGTCCCCACGCGG + Intronic
1165735950 19:38175658-38175680 CTCAGCACTGAGTCCTGAGGAGG - Intronic
1167159055 19:47755823-47755845 GTGCTCACTGTGTCCTGCCGTGG + Intronic
931562171 2:63573582-63573604 ATCATCACAGGGTCCTGAGGCGG - Intronic
933354445 2:81195706-81195728 GCCGTCACTGCCTCCTGACCAGG - Intergenic
933426850 2:82124822-82124844 GTCAGCACTGCTGCCAGACGGGG + Intergenic
936928426 2:117761805-117761827 CTCCTCACTGTGTCCTCACGTGG + Intergenic
938792924 2:134692615-134692637 CTCCTCACTGCGTCCTCACACGG + Intronic
1172312469 20:33929210-33929232 GTTCTCACTGCGTCCTCATGGGG + Intergenic
1175785874 20:61711559-61711581 GTCCTCACAGCGTCCTTATGAGG - Intronic
1179425340 21:41273659-41273681 ATCATCACAGGGTCCTGAGGTGG + Intronic
1182831695 22:33309512-33309534 CTCATTACTGTGTCCTCACGTGG - Intronic
1183618667 22:38960126-38960148 GACATCCCTGCATCCTGACATGG - Intronic
1183639571 22:39084770-39084792 GCCATCCCTGCATCCTGACTTGG - Intronic
1184796478 22:46736276-46736298 GTCATCACTGCTTTCTGCCTTGG - Intronic
954452467 3:50579198-50579220 GTCGTCACTGAGTCCTCCCGTGG - Intronic
956687205 3:71841039-71841061 TTTAACACTGCGTCCTCACGTGG - Intergenic
957778892 3:84793000-84793022 ATCATCACAGGGTCCTGAGGCGG - Intergenic
961180567 3:124873292-124873314 GTCATCACTCTGCCCTGATGGGG + Intronic
969547957 4:7844314-7844336 GTCCTCACTGTGTCCTCACATGG - Intronic
974415890 4:61606485-61606507 GTCCTCACTGTGTCCTTACTTGG + Intronic
981747150 4:148062999-148063021 GTCCTCTCTGCATCCTGCCGGGG - Intronic
984064300 4:175028887-175028909 ATCATCACAGGGTCCTGAGGTGG + Intergenic
985848327 5:2370707-2370729 GTCATAACTGGGTCCTGTCATGG + Intergenic
1012241019 6:96872138-96872160 GTCACCACTGACTCCTTACGAGG - Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1022323707 7:29310728-29310750 GTCCTCACTGTGTCCTCACATGG + Intronic
1025610636 7:63073147-63073169 GGCCTCACAGCGTCCTGATGGGG - Intergenic
1025734715 7:64136830-64136852 ATCATCACAGGGTCCTGAGGTGG - Intronic
1035304434 7:157922333-157922355 GCCAGCACTGCATCCTGACTTGG + Intronic
1036766300 8:11551349-11551371 GTCTTCTCTGTGTCCTCACGTGG + Intronic
1053493805 9:38533755-38533777 GTCCCCACTGCCTCCTAACGCGG + Intergenic
1062488952 9:136795153-136795175 GTCTTCTCTGTGTCCTCACGTGG - Intronic
1186994597 X:15106284-15106306 ATCATCACAGGGTCCTGAGGCGG + Intergenic
1189526342 X:41826350-41826372 GTTATCACTGCGTCCTCACATGG + Intronic
1192746560 X:73944375-73944397 GCAATCACTGCGTCCTTACGGGG + Intergenic
1196951208 X:120876718-120876740 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196952032 X:120933067-120933089 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196952717 X:120937928-120937950 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196953402 X:120942789-120942811 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196954087 X:120947649-120947671 GTCATCACTGAGTGTTGAGGTGG + Intronic
1196954772 X:120952510-120952532 GTCATCACTGAGTGTTGAGGTGG + Intronic
1196955461 X:120957393-120957415 GTCATCACTGAGTGTTGAGGTGG + Intronic
1196956141 X:120962253-120962275 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196956823 X:120967114-120967136 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196957505 X:120971974-120971996 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196958187 X:120976834-120976856 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196958869 X:120981694-120981716 GTCATCACTGAGTGTTGAGGTGG + Intergenic
1196959550 X:120986554-120986576 GTCATCACTGAGTGTTGAGGTGG + Intergenic