ID: 1104877287

View in Genome Browser
Species Human (GRCh38)
Location 12:132044335-132044357
Sequence CCCTCAGCAGGGGGGCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 253}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104877287_1104877296 -1 Left 1104877287 12:132044335-132044357 CCCTCTTGCCCCCCTGCTGAGGG 0: 1
1: 0
2: 0
3: 18
4: 253
Right 1104877296 12:132044357-132044379 GGCACTTGTGCAGCCATGTTTGG 0: 1
1: 0
2: 1
3: 13
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104877287 Original CRISPR CCCTCAGCAGGGGGGCAAGA GGG (reversed) Intronic