ID: 1104877572

View in Genome Browser
Species Human (GRCh38)
Location 12:132046644-132046666
Sequence GCGGCTGGTCAGTAACATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104877569_1104877572 -9 Left 1104877569 12:132046630-132046652 CCCGAAGAGTCCAGGCGGCTGGT 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1104877566_1104877572 -7 Left 1104877566 12:132046628-132046650 CCCCCGAAGAGTCCAGGCGGCTG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1104877567_1104877572 -8 Left 1104877567 12:132046629-132046651 CCCCGAAGAGTCCAGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1104877570_1104877572 -10 Left 1104877570 12:132046631-132046653 CCGAAGAGTCCAGGCGGCTGGTC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104877572 Original CRISPR GCGGCTGGTCAGTAACATAC AGG Intronic
901060925 1:6471604-6471626 GCGCCTGTTCAGCAACATCCCGG - Exonic
906936164 1:50215643-50215665 GCTGCTGGTCACTAACGTAAAGG - Intergenic
912195190 1:107389530-107389552 ACAGCTGGTCACTAAAATACAGG + Intronic
921618541 1:217300353-217300375 GCGGCAGCCCAGCAACATACAGG + Intergenic
1076326802 10:129630105-129630127 GCGGCTGGCCAGCCACAGACTGG - Intronic
1081712578 11:45226850-45226872 GCGGATGGTCATGAACATGCTGG - Intronic
1083604979 11:63973142-63973164 GAGGCTGGACAGTGACATCCGGG + Intergenic
1084000310 11:66292269-66292291 GCGGCTGGACAGCAATATGCGGG + Intronic
1084561736 11:69909457-69909479 GCTGCTGGTCAGTGACAGAGTGG + Intergenic
1091267028 11:134278564-134278586 GTGGCTGGTCAGTTGTATACAGG - Intronic
1099882754 12:88488093-88488115 GCAGCTGGTCTGTGACAAACAGG + Intergenic
1104877572 12:132046644-132046666 GCGGCTGGTCAGTAACATACAGG + Intronic
1111417586 13:87969113-87969135 GCTCCTGGTCAGTGATATACAGG - Intergenic
1111882773 13:93979146-93979168 GTGGCTGGTGAGTACCATATTGG - Intronic
1115114689 14:29865878-29865900 ATGGATAGTCAGTAACATACAGG - Intronic
1115760543 14:36576672-36576694 ACGGCTGGTAAGTGACATAGAGG - Intergenic
1163236687 19:16034127-16034149 GGGCCTGGTCAGTGACATCCTGG + Intergenic
932629994 2:73332713-73332735 ACAGCTGGTCTGTAACATTCTGG - Intergenic
936017645 2:108971922-108971944 GCTGCTGCTCAGTCACATAGGGG + Intronic
940268313 2:151863416-151863438 GCTGCTGGATAGAAACATACAGG + Intronic
942550853 2:177117464-177117486 GAGGCTGGTGACTACCATACTGG + Intergenic
1180211112 21:46295884-46295906 GCGGCTGGGCAGTTCCATCCTGG + Intronic
951228986 3:20155005-20155027 GCAGCTGGTCAATCACATTCTGG - Intergenic
987559662 5:19503587-19503609 GCTCCTCGTCTGTAACATACAGG - Intronic
1006392468 6:33766577-33766599 GCGGCTGGTCAGAATCATAAGGG - Intergenic
1010201127 6:73283007-73283029 GCCACTGGGCAGTTACATACCGG + Intronic
1010654193 6:78492519-78492541 GCAGCTGGTCACTGACATCCAGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1024547952 7:50538149-50538171 GCGGTTGGGAAGGAACATACGGG + Intronic
1038266007 8:26040534-26040556 GGGGCAGGTCAGAAACAAACTGG + Intronic
1053662099 9:40291231-40291253 GCGGCTGGTCAGTAGGAACCTGG + Intronic
1053912548 9:42921399-42921421 GCGGCTGGTCAGTAGGAACCTGG + Intergenic
1054374226 9:64437471-64437493 GCGGCTGGTCAGTAGGAACCTGG + Intergenic
1054522511 9:66085053-66085075 GCGGCTGGTCAGTAGGAACCTGG - Intergenic
1056493960 9:87137301-87137323 GCGGCTGGTCATTACCAAACTGG + Intergenic
1057557376 9:96098725-96098747 GGGGCTGGTCAGTGACACAGAGG + Intergenic
1188584705 X:31759051-31759073 GCAGGTTGTCAATAACATACAGG + Intronic
1189184253 X:39038758-39038780 GTGGCTGGTAATTACCATACTGG - Intergenic
1190748466 X:53341007-53341029 GCTGCTGGTCATCAACACACTGG + Intergenic