ID: 1104880531

View in Genome Browser
Species Human (GRCh38)
Location 12:132067719-132067741
Sequence GGGGGTATAGTCTGTGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104880531 Original CRISPR GGGGGTATAGTCTGTGAGGA TGG Intronic
901868259 1:12122062-12122084 GGGGGCAGAGTGAGTGAGGAGGG + Intronic
904571210 1:31466919-31466941 AGGGGCATAGTCTGTGAGCTGGG - Intergenic
905910561 1:41650379-41650401 GGAGGTACAGACTCTGAGGAAGG + Intronic
906720265 1:47998891-47998913 GGGCAGATAGTCAGTGAGGAGGG + Intergenic
908680135 1:66651616-66651638 GGGGAGAAAGTCTGTGAGGTGGG - Intronic
908811762 1:67988639-67988661 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
909928742 1:81470388-81470410 GGGGGTAGAATCTGTTGGGAAGG - Intronic
910711829 1:90189976-90189998 GGAGCTATAGTCTGGGAGGATGG - Intergenic
910832915 1:91478528-91478550 GGAAGTATAGTCTGAGAAGAGGG + Intergenic
912415825 1:109507785-109507807 GGTGGTATAGGCTGTGTTGAGGG + Exonic
915167714 1:153957973-153957995 TGGGGTATGGCCTGGGAGGAGGG - Intronic
918483012 1:184999981-185000003 GAGGGTGGAGTCTGGGAGGAGGG - Intergenic
918827333 1:189341113-189341135 GAGGGTATAGGTTGGGAGGAAGG + Intergenic
918935281 1:190913594-190913616 GGGATTATAGGCTGTTAGGAAGG - Intergenic
919023454 1:192137695-192137717 GAGGGTAGAGGGTGTGAGGAGGG + Intergenic
919134271 1:193488831-193488853 GGGGGTAGAAGCTGGGAGGATGG - Intergenic
919456110 1:197820824-197820846 GGGGGTAGGGTGAGTGAGGATGG + Intergenic
919878393 1:201886998-201887020 AGGGGTATACACTTTGAGGAGGG + Intergenic
919878398 1:201887031-201887053 AGGGGTATACACTTTGAGGAAGG + Intergenic
919896248 1:202011370-202011392 GGGGGAATAGGCAGGGAGGAGGG + Intronic
922030248 1:221790540-221790562 GGGGGAATATCCTGTGTGGAGGG + Intergenic
923688849 1:236174013-236174035 GGGGGTTTATGCTGGGAGGAGGG - Intronic
1067432342 10:46252667-46252689 GGGGATAGAGGCTGTGGGGATGG - Intergenic
1067776823 10:49170336-49170358 GGGGGTGAAGTCAATGAGGAAGG - Intronic
1068789921 10:61017038-61017060 GGGGGCATATGCTGTGGGGAGGG + Intergenic
1070462619 10:76684970-76684992 GGAGGTACAGCCTCTGAGGAGGG + Intergenic
1070732961 10:78844184-78844206 GGGTGTATGCTCTGGGAGGAGGG + Intergenic
1072839796 10:98759184-98759206 GAGGGTAGAGTGTGGGAGGAGGG + Intronic
1073251626 10:102123378-102123400 GGGGGTGGAGTCTATGTGGAGGG + Intergenic
1074109393 10:110411602-110411624 GGGAGGGTAGTCTGTGAGGAGGG + Intergenic
1077421737 11:2453665-2453687 GAGGGTAGACTCTGTGAGGAAGG + Intronic
1083580628 11:63822899-63822921 GTGGGCAAAGTCTGAGAGGAAGG + Intronic
1083675433 11:64322493-64322515 GGGGGTCAAGTCTGAAAGGATGG - Intergenic
1086548148 11:88022999-88023021 GAGGGTATAGAGTGAGAGGAAGG + Intergenic
1090538397 11:127672243-127672265 GGGGATATGGATTGTGAGGAGGG - Intergenic
1095480550 12:42630618-42630640 GGTGATATAGTTAGTGAGGAAGG + Intergenic
1095635081 12:44423339-44423361 GGTGATAATGTCTGTGAGGATGG + Intergenic
1102040276 12:109796489-109796511 GGGGGCATGGGGTGTGAGGAAGG - Intronic
1102914624 12:116743695-116743717 GGGGGTATGGGATGTGAGGAAGG - Intronic
1104846976 12:131851685-131851707 GGGGGGCTCGTCTGTGGGGAGGG - Exonic
1104880531 12:132067719-132067741 GGGGGTATAGTCTGTGAGGATGG + Intronic
1105619162 13:22050281-22050303 GGGGGTGGAGGCTGGGAGGAGGG + Intergenic
1105685668 13:22778766-22778788 GGGGGTATAATCTGGGAAAAGGG - Intergenic
1107240615 13:38230117-38230139 GAGGGTATAGGATGGGAGGAAGG + Intergenic
1108325801 13:49329901-49329923 GGGAGTATAGACAGTGAGAAAGG - Intronic
1108701468 13:52947837-52947859 GGTGGTATACTCTGTGAGGAAGG + Intergenic
1111914789 13:94349570-94349592 TAGGGGATAGTGTGTGAGGATGG - Intronic
1113331726 13:109333960-109333982 GGTGGTATAGTTTGGGAGGGAGG + Intergenic
1114910101 14:27181601-27181623 AGGGGTGTGTTCTGTGAGGAAGG - Intergenic
1118816322 14:69316760-69316782 GGGCTTGTAGTCTGTGAGGGGGG + Intronic
1120571952 14:86129650-86129672 TGGGATTTAATCTGTGAGGAGGG + Intergenic
1121465023 14:94110254-94110276 GCTGGTAAACTCTGTGAGGATGG + Intronic
1122144101 14:99678680-99678702 AGGGGTATAGGCTGTGAGCTGGG + Exonic
1122707061 14:103628467-103628489 CGGGGTGTAGACTGTGAGGGTGG - Intronic
1125437459 15:39662156-39662178 GGGGGAAAGGGCTGTGAGGAGGG + Intronic
1128660458 15:69497181-69497203 GGTGCTACAGTCTGTGTGGAAGG - Intergenic
1129660900 15:77552378-77552400 GGAGGTCAAGTCTGTCAGGAAGG + Intergenic
1138209985 16:55155406-55155428 CTGGGAATAGTCTGTGAAGATGG + Intergenic
1138903079 16:61297640-61297662 GGAGAGATAGTATGTGAGGAAGG + Intergenic
1141084287 16:81080552-81080574 GTGGTTATAGTCTCTGAAGAAGG - Intergenic
1141832475 16:86517424-86517446 GGAGGGAAAGTCTGTGAAGATGG - Intergenic
1142388565 16:89783037-89783059 TGAGATGTAGTCTGTGAGGAGGG + Exonic
1143545210 17:7591444-7591466 GGGGGTACAGGATGGGAGGAGGG + Exonic
1147314231 17:39611963-39611985 GGGGGCAGAGTGTGTGTGGAGGG + Intergenic
1149147559 17:53514519-53514541 GAGGGTTTAGTGTGTAAGGATGG + Intergenic
1150595755 17:66602910-66602932 GGGGATTCAGTCTGTGAGGCGGG + Intronic
1152233537 17:79126575-79126597 GGGTGTATAGACAGGGAGGAGGG - Intronic
1155672932 18:28394100-28394122 GAGGGTAGAGAATGTGAGGAAGG + Intergenic
1156409396 18:36813224-36813246 GAGGGAAGAGTCTGCGAGGAAGG + Intronic
1157741220 18:50095156-50095178 GAGGGGATACTCTGTGAGAAAGG - Intronic
1160040949 18:75345000-75345022 GGAGGCACAGGCTGTGAGGAAGG + Intergenic
1161027451 19:2043094-2043116 GGGGCTCCAGGCTGTGAGGAGGG - Intronic
1162035016 19:7933982-7934004 GGGGGTGGAGTCCGTGAAGAAGG - Exonic
1162862534 19:13517591-13517613 GAGGGTTTAGTGTGGGAGGAGGG + Intronic
1162969300 19:14170470-14170492 GGGGACAGAGTCTGTGAGGCGGG + Intronic
1165344959 19:35239592-35239614 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
1166001919 19:39882640-39882662 AGGGGTATAGTCTCTGATGTGGG - Intronic
1166004701 19:39898891-39898913 GGGGGTATAGTCTCTGATGTGGG - Intronic
1166258522 19:41621843-41621865 AGGGGCATAGTCAGGGAGGAAGG + Intronic
1166583284 19:43922436-43922458 GGGGGCATACTCTGTGTGGTCGG - Intronic
1168239951 19:55083911-55083933 GTGGGTAAAGTCTGAGAGGTTGG + Intronic
929412143 2:41708846-41708868 GAGGGTAGAGTGTGGGAGGAGGG - Intergenic
930369530 2:50485697-50485719 GTGGTAAGAGTCTGTGAGGAGGG + Intronic
934042845 2:88144060-88144082 GGTGATAGAGTCTTTGAGGAAGG + Intergenic
934159194 2:89232060-89232082 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934167542 2:89308016-89308038 GGGGGCAGAGACTGTGAGGAAGG + Intergenic
934199732 2:89874430-89874452 GGGGGCAGAGGCTGTGAGGAAGG - Intergenic
934208078 2:89950365-89950387 GGGGGCAGAGACTGTGAGGAAGG - Intergenic
934790238 2:97053661-97053683 GGGGGCAGTGACTGTGAGGAAGG - Intergenic
934816230 2:97328876-97328898 GGGGGCAGTGACTGTGAGGAAGG + Intergenic
934821466 2:97379608-97379630 GGGGGCAGTGACTGTGAGGAAGG - Intergenic
935114158 2:100120272-100120294 GGGGGTAAATTCTGTGACCACGG - Intronic
937956583 2:127425075-127425097 GGGAGTCAAGTCAGTGAGGAGGG + Intronic
942028619 2:171935910-171935932 GGGGGTATAGGGAGTGAGGTAGG + Intronic
942716170 2:178895015-178895037 TGGGGTAGAGTAGGTGAGGAGGG - Intronic
944938991 2:204602594-204602616 GGGGATACAGTCTGTGACAATGG - Intronic
945702933 2:213193790-213193812 GGGAGTATAGGCTCTGTGGAAGG + Intergenic
948609749 2:239159377-239159399 GTGGGTATAGGTTGTGAGGGGGG - Intronic
1171354589 20:24534290-24534312 AGGGGTGGAGGCTGTGAGGAGGG - Intronic
1173028727 20:39334575-39334597 GGGGGCATAGTCTGAAAGGGGGG - Intergenic
1173045269 20:39503734-39503756 GGAGGAAGAGTCTGTAAGGAAGG + Intergenic
1174181719 20:48679370-48679392 GGGTGTAGAGGCTGTGAAGACGG + Exonic
1179646762 21:42780869-42780891 GCGGGTATAGACAGTGAGAAAGG + Intergenic
1179881282 21:44294277-44294299 GGGGGTGTGGGGTGTGAGGAAGG - Intronic
1181413942 22:22746184-22746206 GGGGGTATAGTGTGAGGTGATGG + Intronic
1183183497 22:36277860-36277882 GGGGGTGGTGGCTGTGAGGAGGG - Intergenic
1184502112 22:44880537-44880559 GGGAGAATAGTTTGGGAGGAGGG - Intergenic
1185350971 22:50337999-50338021 GTGGGTATAGTGTGTGTGGGGGG + Intergenic
950133262 3:10562231-10562253 GGGGCTAGAGGCAGTGAGGAGGG + Intronic
954137442 3:48588511-48588533 GGGGGCAGGGTCTGAGAGGAGGG - Intronic
954467653 3:50665897-50665919 TGGGGTATGAACTGTGAGGAGGG - Intergenic
954482064 3:50808927-50808949 TGGAGTATATTCTGTGAGGCAGG - Intronic
956710171 3:72032169-72032191 CAGGGTATAGTCTGTGAAAAAGG - Intergenic
958602379 3:96312864-96312886 TGGAGTAAAGTCTGTGATGAAGG + Intergenic
959430843 3:106252918-106252940 GAGGGTAAAGGGTGTGAGGAGGG + Intergenic
961380603 3:126494361-126494383 GGGGGGATAGCCTGAGAGGATGG - Intronic
963087240 3:141449473-141449495 AGGAGTAGAGTCTGTGACGACGG - Exonic
963947177 3:151159354-151159376 TATGGTATAGTCTGTGGGGAGGG - Intronic
966600986 3:181774797-181774819 GGGGGGATAGTGTGGGAAGAGGG + Intergenic
967839257 3:193991620-193991642 AGGGATATAGGCTGTGGGGAAGG - Intergenic
973824717 4:54693598-54693620 GGGGGCATATTCTGAGGGGAGGG - Intronic
974928029 4:68325777-68325799 GGTGGTATATTCTGTGATGGAGG + Intronic
975424115 4:74206496-74206518 GGGAGTATATACTGTGAGAAAGG + Intronic
977150673 4:93507746-93507768 GAGGGTATAGTCTGTGATTCTGG - Intronic
977261792 4:94805696-94805718 GGGGGTATAGTGTCAAAGGAGGG + Intronic
978889587 4:113807897-113807919 AGGAGTATATTCTCTGAGGAAGG + Intergenic
979167840 4:117558823-117558845 AGGGGAAAAGTCTCTGAGGAAGG - Intergenic
979709948 4:123767682-123767704 GAGGGTAGAGGGTGTGAGGAGGG + Intergenic
980201592 4:129662029-129662051 TGGTGTATTGTTTGTGAGGAGGG + Intergenic
983398567 4:167234314-167234336 GGGGGTAAAGCCTGCGGGGAGGG - Intronic
983696914 4:170543614-170543636 GGGGGTAGAGGGTGGGAGGAGGG + Intergenic
986589577 5:9354766-9354788 CATGGTAGAGTCTGTGAGGAAGG + Intronic
992615053 5:78539583-78539605 GGTGGGATAGTCTGAGATGATGG - Intronic
992847076 5:80761251-80761273 GGGATTACAGTCTGTGAGGCGGG - Intronic
992998636 5:82357509-82357531 AGGGAAATAGTCTGGGAGGAGGG + Intronic
993123218 5:83800765-83800787 GGGGATACAGTTGGTGAGGAAGG - Intergenic
994218917 5:97172039-97172061 GAAGGTATGATCTGTGAGGAAGG - Intronic
998720448 5:144940692-144940714 GTGGGGGGAGTCTGTGAGGAGGG + Intergenic
999580467 5:153032784-153032806 GGGGTTAAGGCCTGTGAGGAAGG - Intergenic
1000038009 5:157463392-157463414 GGGGCTGTAGTCTAAGAGGATGG + Intronic
1000964760 5:167642850-167642872 GTGGATATAGTATGTGAGAAAGG + Intronic
1002304191 5:178273786-178273808 GTGGGTATGGTCACTGAGGAGGG + Intronic
1002714869 5:181220689-181220711 GGCTATATAGTCTGTGAGGGCGG - Intergenic
1002773182 6:306866-306888 GGGGGTGTAGACTGGGAAGATGG + Intronic
1004793706 6:19057575-19057597 GGGGGTAGAGGGTGGGAGGATGG + Intergenic
1005892849 6:30154193-30154215 GGGGGTGTGGGCTGTGAGGCTGG - Exonic
1007958537 6:45938383-45938405 GGGGGTATTGGGTGGGAGGAAGG + Intronic
1008130640 6:47716941-47716963 GGGAGTTGAGTTTGTGAGGATGG + Intronic
1015505784 6:133986134-133986156 GGGGGTAAAGTGAGTCAGGAAGG + Intronic
1015660915 6:135572371-135572393 GAGGCAATACTCTGTGAGGATGG + Intergenic
1018244085 6:161805330-161805352 GGGTATAAGGTCTGTGAGGATGG - Intronic
1018829709 6:167433587-167433609 GGTGGTAGAGTGTGTGTGGATGG + Intergenic
1021222033 7:17985743-17985765 GAGGGTATAGTTTGTGAAGTGGG - Intergenic
1022888144 7:34667558-34667580 GGGTGGAGAGTCTTTGAGGATGG - Intronic
1026345074 7:69466642-69466664 GGGAGAATAGTTTGTGAAGATGG - Intergenic
1030733779 7:113019654-113019676 GAGGGTAGAGGCTGTGAGGAGGG - Intergenic
1033356963 7:140607781-140607803 GTGGGTTTGGTCTGTGTGGAGGG - Intronic
1035407597 7:158609750-158609772 GTGAGTATAGTGGGTGAGGAGGG + Intergenic
1035738297 8:1905388-1905410 GCGGTGAAAGTCTGTGAGGAAGG + Intronic
1037477175 8:19269355-19269377 GATGGTTTAGTCTGTGAGGCAGG - Intergenic
1045347375 8:101305136-101305158 GGGGCAATAGTCTGCGAGAAGGG + Intergenic
1046873457 8:119228505-119228527 GAGGCACTAGTCTGTGAGGATGG - Intronic
1047108041 8:121756507-121756529 GGTGGTAAAGGCAGTGAGGAGGG + Intergenic
1048699150 8:137068135-137068157 GGTGGTGAAGTCAGTGAGGATGG + Intergenic
1049659295 8:143812594-143812616 GGCGGTGGAGTCTGTGAGGGCGG - Intronic
1050134050 9:2442633-2442655 GGGGATATATGCTCTGAGGAAGG + Intergenic
1052087336 9:24283843-24283865 GGAGGTACAGTCTGTGGAGAGGG + Intergenic
1054154943 9:61633528-61633550 AGGGGTAGGGTCTGTGAGGCTGG - Intergenic
1056694185 9:88832502-88832524 GAGGGTGTGGTCTGTGAGGGGGG - Intergenic
1059601634 9:115784999-115785021 GAGGGTAGAGGCTGGGAGGAGGG + Intergenic
1187600217 X:20820951-20820973 GAGGGTAGAGGCTGGGAGGAGGG + Intergenic
1188140960 X:26550435-26550457 GAGGGAAGAGTCTGGGAGGAGGG - Intergenic
1188828942 X:34872559-34872581 GAGGGTAGAGTGTGGGAGGAGGG + Intergenic
1188880318 X:35484418-35484440 GAGGGTGGAGTCTGGGAGGAGGG - Intergenic
1190213590 X:48466477-48466499 GGGGGCAGAGTCTGGGAGGTGGG + Intronic
1190642324 X:52492725-52492747 GAGGGTAGAGGCTGGGAGGAGGG - Intergenic
1190645349 X:52520142-52520164 GAGGGTAGAGGCTGGGAGGAGGG + Intronic
1193165959 X:78280726-78280748 GAGGGTAGAGGCTGTGAGGAGGG - Intronic
1193857042 X:86615917-86615939 GAGGGTAGAGTGTGGGAGGAGGG - Intronic
1193884131 X:86963767-86963789 GTGGGTATAGGCTGTGATGGTGG - Intergenic
1194460473 X:94161097-94161119 GAGGGTAGAGACTGTGAGAAGGG - Intergenic
1200071006 X:153529321-153529343 GGGGGTAGGGTGTGTGGGGAAGG + Intronic