ID: 1104881909

View in Genome Browser
Species Human (GRCh38)
Location 12:132077628-132077650
Sequence GTGTCTTTAGCCTGACAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104881909_1104881913 6 Left 1104881909 12:132077628-132077650 CCCTGCTGTCAGGCTAAAGACAC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1104881913 12:132077657-132077679 AGCCTCCGTGCCAGTAGTCAGGG 0: 1
1: 0
2: 0
3: 8
4: 170
1104881909_1104881917 14 Left 1104881909 12:132077628-132077650 CCCTGCTGTCAGGCTAAAGACAC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1104881917 12:132077665-132077687 TGCCAGTAGTCAGGGCAGCAGGG 0: 1
1: 0
2: 0
3: 24
4: 241
1104881909_1104881912 5 Left 1104881909 12:132077628-132077650 CCCTGCTGTCAGGCTAAAGACAC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1104881912 12:132077656-132077678 AAGCCTCCGTGCCAGTAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 186
1104881909_1104881916 13 Left 1104881909 12:132077628-132077650 CCCTGCTGTCAGGCTAAAGACAC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 1104881916 12:132077664-132077686 GTGCCAGTAGTCAGGGCAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104881909 Original CRISPR GTGTCTTTAGCCTGACAGCA GGG (reversed) Exonic
905998592 1:42403783-42403805 GTGTCCTTAGGCTGAAATCATGG + Intronic
906291183 1:44620130-44620152 GTGTCTTTAGGGAGGCAGCATGG + Intronic
912603645 1:110965100-110965122 GTGTGTTTAGCCAGACAACCTGG - Intergenic
918456656 1:184726933-184726955 GTGTTGTTAGCCTGCCAGCAAGG - Intronic
924007829 1:239631642-239631664 GTGTACTGAGCCTGACAGCTAGG - Intronic
1065164896 10:22966183-22966205 CTGTTTTTAGCCTGACTCCATGG + Intronic
1067228719 10:44392149-44392171 GTGTCTGTAGTCTTACTGCATGG + Intergenic
1073466225 10:103696009-103696031 TTGTCTTGAGCCTCAGAGCAAGG - Intronic
1076135961 10:128045898-128045920 GTGTCAGTAGCCTGGCAGCCTGG - Intronic
1079299541 11:19265552-19265574 GTGTTTTTTGACTGGCAGCAAGG + Intergenic
1079310355 11:19360159-19360181 CTGTCTTTGGCCTGCCAGCCTGG + Intronic
1079328251 11:19512523-19512545 GTGGTTTTAGCCTACCAGCAGGG - Intronic
1081957088 11:47102928-47102950 GCCTCTTTAGCCTTACAGAAAGG + Intronic
1090011925 11:123052981-123053003 GTGTCTTTATCTTGGCAACATGG + Intergenic
1090633915 11:128676435-128676457 GTGTCTTTTGCCTTCCACCATGG + Intergenic
1092052960 12:5485980-5486002 GTGTCTGAAGACTGACAGCTGGG - Intronic
1092127042 12:6081861-6081883 GTATCTGAAGCCAGACAGCAAGG + Intronic
1094377219 12:29802639-29802661 GGGGCTTTAGCCAGACTGCAAGG + Intergenic
1099428515 12:82553203-82553225 GGATCTTTAGCCTGAGAACATGG + Intergenic
1100002021 12:89848786-89848808 GTGTCCTCAGCCAGAAAGCAAGG - Intergenic
1100443217 12:94636896-94636918 GTGTCATCAGCCTGAAATCAAGG - Intronic
1104546757 12:129720158-129720180 TTGTAATTAGCCTGACACCAGGG - Intronic
1104881909 12:132077628-132077650 GTGTCTTTAGCCTGACAGCAGGG - Exonic
1105484303 13:20811765-20811787 GGGTTTTTACCCTGACAGCTGGG + Intronic
1108069770 13:46616432-46616454 TGGTCATAAGCCTGACAGCACGG + Intronic
1108395741 13:49989528-49989550 GTGTCTTTTGCCTGACTGGGAGG + Intergenic
1112320523 13:98403022-98403044 CTGTCTTTACCCTCAAAGCATGG + Intronic
1113528773 13:111004493-111004515 GGGTCTGAAGCCTGACAGCTTGG - Intergenic
1123424720 15:20160784-20160806 TTGCCTTTAGTCTGACACCATGG - Intergenic
1123533944 15:21167315-21167337 TTGCCTTTAGTCTGACACCATGG - Intergenic
1123912759 15:24985169-24985191 GAGTCCTTAGACTGACAGTAAGG - Intergenic
1124534086 15:30529546-30529568 TTGTCCTAAGCCTTACAGCAGGG + Intergenic
1124764561 15:32478064-32478086 TTGTCCTAAGCCTTACAGCAGGG - Intergenic
1128200265 15:65799260-65799282 CTCTCTTTAGCCTGACATCAAGG - Intronic
1128610031 15:69065850-69065872 CTGTCTTTAATCTGAAAGCAAGG + Intergenic
1129699881 15:77761758-77761780 GTGTCTGTAGCCTCTCTGCAAGG + Intronic
1133574990 16:7080387-7080409 CTGTCTTTATCCTGGCAGAACGG + Intronic
1137520128 16:49186280-49186302 GTTTCTTTAGCCTGATTTCAAGG - Intergenic
1203121640 16_KI270728v1_random:1543118-1543140 TTGCCTTTAGTCTGACACCATGG + Intergenic
1142623055 17:1177176-1177198 CTGTCATTTGCCTGGCAGCAAGG - Intronic
1143095010 17:4474095-4474117 GTGTCTGTTGGCTGGCAGCACGG + Intronic
1143181017 17:4984259-4984281 GATTCTTTAGCCTGACTCCAAGG + Intronic
1146842572 17:36166152-36166174 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146854884 17:36254111-36254133 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146865736 17:36334265-36334287 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1146870784 17:36378003-36378025 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1146882092 17:36450231-36450253 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147068606 17:37934877-37934899 GGGTGTTCAGCCTGCCAGCAGGG - Exonic
1147073668 17:37978627-37978649 GGGTGTTCAGCCTGCCAGCAGGG + Intronic
1147080128 17:38014414-38014436 GGGTGTTCAGCCTGCCAGCAGGG - Intronic
1147085189 17:38058165-38058187 GGGTGTTCAGCCTGCCAGCAGGG + Exonic
1147096077 17:38138374-38138396 GGGTGTTCAGCCTGCCAGCAGGG - Intergenic
1147101135 17:38182131-38182153 GGGTGTTCAGCCTGCCAGCAGGG + Intergenic
1147552985 17:41457995-41458017 AGGTCATTAGCCTGACAGCAGGG - Intergenic
1153783187 18:8512226-8512248 GAATCTGTAGCCAGACAGCAAGG - Intergenic
1166393060 19:42420839-42420861 GGGGCTTTATCCTGAAAGCAAGG - Intronic
1167232054 19:48291035-48291057 GTCTCTGGTGCCTGACAGCACGG - Intergenic
1168647816 19:58072208-58072230 GTGGCTTCATCCTCACAGCATGG - Intronic
928439358 2:31279062-31279084 GTGTCTTTTGTCTGCCAACAAGG + Intergenic
928727956 2:34197006-34197028 GTTTGTTTTGCCTCACAGCAAGG - Intergenic
934458498 2:94196075-94196097 TTGTCTTTAGTCTGACACCATGG + Intergenic
936742281 2:115527541-115527563 GTATTTTTAGCCTGAAAACAGGG - Intronic
938251908 2:129821959-129821981 GTGTCTTTCGCCTGCCACCCTGG - Intergenic
939536109 2:143431120-143431142 CTATCTTTAGCCTAACTGCAAGG + Intronic
942099667 2:172567455-172567477 GTCTCTTTTTCCTGAAAGCATGG + Intronic
946393922 2:219434053-219434075 GTTTCTCTACCCTGAAAGCAGGG - Intergenic
947925063 2:233914150-233914172 GTGTATTCAGCCTAACACCATGG - Intergenic
948124930 2:235557643-235557665 GTTTCCTTATCCAGACAGCAGGG - Intronic
1172283918 20:33727815-33727837 CTGACTTTACCCTGCCAGCAAGG + Intergenic
1180920467 22:19519067-19519089 CTGTCCTTAGGCTGCCAGCAGGG + Intronic
1181357707 22:22310359-22310381 TTGCCTTTAGTCTGACACCATGG - Intergenic
1185328332 22:50238895-50238917 GTGGCTTTATCCTGACTGCCAGG - Intronic
953780990 3:45870229-45870251 GTGGGTGTAGCCTGACAGCCAGG - Intronic
954087349 3:48255979-48256001 GTTTCTTTAGCCTGTTAACATGG + Intronic
954239270 3:49280805-49280827 TTGTCTGTAACCTGTCAGCAAGG - Exonic
956158578 3:66324222-66324244 GTGTGTGTAGTTTGACAGCAGGG + Intronic
956499384 3:69865711-69865733 GGATCTCTAGCCTGTCAGCAAGG + Intronic
961112471 3:124296717-124296739 GTTTCTGGAGCCTGACATCAAGG - Intronic
961544282 3:127621381-127621403 GTGCCTGTAGTCTGACAGCAGGG + Intronic
961685003 3:128623898-128623920 ATGTGTGTAGCCTGAGAGCAAGG - Intronic
964920633 3:161891493-161891515 TTGTCTCTAGCCTTACAGCTTGG + Intergenic
965009210 3:163063876-163063898 GTGTCTTTGGTTTCACAGCAGGG - Intergenic
965313101 3:167156341-167156363 GGTTATTTTGCCTGACAGCACGG - Intergenic
970449054 4:16149012-16149034 CTGTCTTAATCCTCACAGCAAGG - Intergenic
971264573 4:25086605-25086627 GTGTCTTTAGCATGATATCAAGG + Intergenic
974794983 4:66737017-66737039 GTTTCTTGTGGCTGACAGCAAGG + Intergenic
975453420 4:74557799-74557821 ATGTCTTTATCATCACAGCATGG - Intergenic
976525458 4:86082925-86082947 AGGTATTTTGCCTGACAGCATGG - Intronic
983895252 4:173074557-173074579 CTGCCTTAAGCATGACAGCAGGG - Intergenic
986848691 5:11784847-11784869 GTGTCATTAGACTGAAATCAAGG - Intronic
987877468 5:23697128-23697150 AGGTATTTTGCCTGACAGCATGG + Intergenic
988325366 5:29759055-29759077 AGGTATTTTGCCTGACAGCAAGG + Intergenic
997858763 5:137397135-137397157 GACTCTTTGGCCTGACATCATGG - Intronic
1011488123 6:87864378-87864400 CTGGCTTTAGCCTGATACCATGG + Intergenic
1014631297 6:123793547-123793569 GTGTCTTTGAGCTGCCAGCATGG + Intergenic
1016320227 6:142835022-142835044 GATTCTTTAGCCTGTCAACATGG - Intronic
1016742375 6:147541946-147541968 GTGTTTGTAGCCTCACTGCAGGG - Intronic
1016924901 6:149334953-149334975 GTGACTTTAGGTTGCCAGCATGG + Intronic
1017550116 6:155496693-155496715 GTTTATTCAGCCAGACAGCATGG - Intergenic
1017841984 6:158229880-158229902 TTCTCTTTAGTCTGACAGCAAGG + Intergenic
1022401424 7:30042173-30042195 GGGTCTTGAGCCTGCTAGCATGG + Intronic
1026793433 7:73350099-73350121 GGGTCTGTGGCCGGACAGCAGGG - Intronic
1026959099 7:74397293-74397315 GTCTCCATGGCCTGACAGCAAGG - Intronic
1028486838 7:91368401-91368423 GTGACTGTAGAATGACAGCATGG - Intergenic
1030364167 7:108627134-108627156 GTGTCTGTAGCCTCATTGCAGGG - Intergenic
1032985004 7:137328132-137328154 GGGTCTTTAATCTGGCAGCATGG - Intronic
1039469964 8:37807250-37807272 ATGCATTTAGCCTGACTGCAAGG - Intronic
1040989465 8:53334732-53334754 AGGTGTTTTGCCTGACAGCACGG + Intergenic
1041722298 8:60987072-60987094 CTGTCATTTGCCTGAGAGCAGGG - Intergenic
1042787053 8:72559451-72559473 GTGTCTTAATCCTGAGAGCCAGG + Intronic
1043700418 8:83280491-83280513 GTTTCTTAATCCTGACATCATGG - Intergenic
1044046315 8:87438546-87438568 ATGTCTTTAGCCAGAAAGCTTGG - Intronic
1048688976 8:136937283-136937305 CTGTCTTGAGCCTTAAAGCATGG + Intergenic
1053689004 9:40571891-40571913 TTGTCTTTAGTCTGACACCATGG + Intergenic
1054275030 9:63059175-63059197 TTGTCTTTAGTCTGACACCATGG - Intergenic
1054300247 9:63372823-63372845 TTGTCTTTAGTCTGACACCATGG + Intergenic
1054399799 9:64705754-64705776 TTGTCTTTAGTCTGACACCATGG + Intergenic
1054433385 9:65190015-65190037 TTGTCTTTAGTCTGACACCATGG + Intergenic
1054497000 9:65831654-65831676 TTGTCTTTAGTCTGACACCATGG - Intergenic
1055939493 9:81636204-81636226 GTGTCTTTGGGATGACAGGAAGG - Intronic
1056021534 9:82443020-82443042 GTGTCTTTTGCCTCCCACCATGG - Intergenic
1059334116 9:113557939-113557961 GTGACTTTATCCTGAGTGCAGGG + Intronic
1061626484 9:131843547-131843569 GTGGCTTCAGCCTGCCTGCAAGG - Intergenic
1195912479 X:109902558-109902580 GTTTCTCTAGGTTGACAGCAAGG + Intergenic