ID: 1104882769

View in Genome Browser
Species Human (GRCh38)
Location 12:132084128-132084150
Sequence GCGGAGCCAGAGGCGCGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 769
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 721}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104882762_1104882769 11 Left 1104882762 12:132084094-132084116 CCCACGTGCGAATGAATGAACAA 0: 1
1: 0
2: 1
3: 7
4: 101
Right 1104882769 12:132084128-132084150 GCGGAGCCAGAGGCGCGCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 721
1104882763_1104882769 10 Left 1104882763 12:132084095-132084117 CCACGTGCGAATGAATGAACAAA 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1104882769 12:132084128-132084150 GCGGAGCCAGAGGCGCGCGCCGG 0: 1
1: 0
2: 3
3: 44
4: 721

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104882769 Original CRISPR GCGGAGCCAGAGGCGCGCGC CGG Intergenic
900109489 1:999532-999554 GCGGAGCCTGCGTCGCGTGCAGG - Exonic
900227574 1:1540251-1540273 GGGGAGCAGGGGGCGCGCGCGGG + Intronic
900344805 1:2205469-2205491 GCAGAACGAGCGGCGCGCGCCGG - Intronic
901007603 1:6179534-6179556 GCGAGGCCAGAGGCGCACGGCGG + Intronic
901086440 1:6614481-6614503 CCGGAGCCAGGGGCGGGCGGCGG - Intronic
901433936 1:9234862-9234884 GCGGAGCCCGCGGCGGCCGCAGG - Exonic
901798066 1:11691865-11691887 GCGGAGCCAGGGGCGGGCCGAGG - Intronic
902680731 1:18042180-18042202 GCGGAGGCAGGGGCCCCCGCGGG + Intergenic
903206018 1:21783094-21783116 GCGGCGGCAGTGGCGCGCACAGG - Exonic
903413798 1:23168177-23168199 GCGGGGCCAGCTGCGGGCGCGGG - Intronic
904238911 1:29131444-29131466 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
904822957 1:33256839-33256861 GCGGCGGCAGCGGGGCGCGCGGG + Intronic
905630339 1:39514894-39514916 GCGCGGCCCGAGGCGCACGCAGG + Intronic
905667421 1:39771295-39771317 GCGCGGCCCGAGGCGCACGCAGG - Exonic
905864017 1:41366957-41366979 GCCGTGACAGAGGCGCCCGCCGG + Intronic
905912112 1:41662270-41662292 GCGGTGCCCCAGGCGCTCGCTGG + Intronic
906168840 1:43707328-43707350 GCGGGGCGAGAGGTTCGCGCTGG - Intronic
906203593 1:43975239-43975261 TCGGAGTCAGAGGCCCTCGCAGG - Intronic
906525245 1:46489846-46489868 GCGGAGGCGGCGGCGCGGGCCGG + Intergenic
908027794 1:59970031-59970053 GTGGAGAGAGAGGCGCGAGCCGG - Intergenic
909904604 1:81178978-81179000 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
910478855 1:87636593-87636615 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
910685742 1:89914325-89914347 GTGGAGGCAGAGGCGTGAGCGGG - Intronic
910693169 1:89984984-89985006 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
911205889 1:95091384-95091406 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
911259639 1:95669994-95670016 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
911440486 1:97920707-97920729 GCGGAGCCACAGGCCCGCGTGGG - Intronic
912166113 1:107044749-107044771 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
912819412 1:112854880-112854902 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
913209535 1:116571153-116571175 CCGAGGCCAGAGGCGCGCCCGGG - Intergenic
913468975 1:119171541-119171563 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
914203468 1:145506219-145506241 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
914482590 1:148079373-148079395 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
914928024 1:151906130-151906152 GTGGAGGGAGAGGCGCGAGCAGG + Intronic
915517288 1:156420915-156420937 GCGGAGCCCGAGCCTGGCGCGGG + Intronic
915764524 1:158349347-158349369 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
915767193 1:158374491-158374513 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
917880812 1:179333963-179333985 GCGGAGCCAGAGGGGCTCAAGGG + Intronic
917933036 1:179837297-179837319 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
918058964 1:181045828-181045850 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
918993858 1:191731808-191731830 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
919167990 1:193919279-193919301 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
919201388 1:194358636-194358658 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
919237002 1:194859060-194859082 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
919297804 1:195723255-195723277 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
919630927 1:199959667-199959689 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
920076698 1:203342367-203342389 GCGCAGGCAGAGGGGCGCGTCGG + Exonic
920528395 1:206685034-206685056 TGGGAGCCAGCGGCGCGCGGTGG + Exonic
920731406 1:208488805-208488827 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
921096253 1:211889542-211889564 GCGGAGGGAGAGGCGCGGGCGGG + Intergenic
921903886 1:220476061-220476083 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
922056791 1:222049741-222049763 GCGGAGGAAGAGGCGCGAGCGGG + Intergenic
922307006 1:224352851-224352873 GTGGAGGCAGAGGCGCGGGCGGG - Intergenic
922496745 1:226063057-226063079 GAGGAGCCAGGGGCGCGGGGAGG - Intronic
922790285 1:228307416-228307438 GCGGAGCCAGGGGGCCACGCGGG + Exonic
922985838 1:229865452-229865474 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
923193484 1:231642272-231642294 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
923930115 1:238684997-238685019 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
924117482 1:240762484-240762506 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1064274213 10:13891815-13891837 TCGGCGCGAGAGGCGCGAGCGGG - Intronic
1064449249 10:15426442-15426464 GTGGAGGGAGAGGCGCCCGCGGG - Intergenic
1065025076 10:21534051-21534073 GGGGAGCCGGCGGCGCGCGGAGG - Intergenic
1065441299 10:25755994-25756016 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1065727113 10:28677370-28677392 GCGGGCCCAGACGCGAGCGCTGG - Exonic
1065743315 10:28816040-28816062 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1065752202 10:28897143-28897165 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1065802571 10:29366188-29366210 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1067024990 10:42836944-42836966 GCGGTTCCAGCGGCGGGCGCGGG - Intergenic
1067060706 10:43076776-43076798 GCGGACCCCGAGGTGCGCGGCGG - Intergenic
1067111881 10:43407264-43407286 GCGGGACGCGAGGCGCGCGCTGG - Intronic
1068373983 10:56155116-56155138 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1068863131 10:61867638-61867660 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1068978098 10:63033582-63033604 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1069090849 10:64197138-64197160 GGGGAGGGAGAGGCGCGGGCGGG - Intergenic
1069818362 10:71212740-71212762 CCGGAGCCAGAGGGGCGCGCCGG + Exonic
1069992932 10:72325949-72325971 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1070302103 10:75210987-75211009 GCCAAGCCGGAGGCCCGCGCCGG + Intronic
1070564101 10:77590554-77590576 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1070835922 10:79446678-79446700 GCGGAGGCGGAGGCGGGGGCGGG - Intergenic
1070942594 10:80359856-80359878 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1071055670 10:81505820-81505842 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1071794582 10:88990996-88991018 GCGGCGGCAGCGGCGCACGCGGG + Exonic
1072278463 10:93845182-93845204 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1072435903 10:95414612-95414634 AAGGAGCCAGAGGCGCGGGCTGG + Exonic
1072503786 10:96044062-96044084 GCGGAGCCAGGTGCGAGCTCGGG - Intronic
1072781630 10:98255631-98255653 GCAGTGCCAGAGGCACGGGCCGG - Exonic
1073289977 10:102408755-102408777 GGGCAGCCAGAGGCGGGCACGGG - Intronic
1073878280 10:107950573-107950595 GTGGAGGGAGAGGCGCGTGCGGG + Intergenic
1074316972 10:112369781-112369803 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1074584686 10:114755716-114755738 GCGGAGCCAGAGGCAGGTGTGGG - Intergenic
1074996384 10:118760514-118760536 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1075207072 10:120457167-120457189 GCGGGGGCGGAGGCGGGCGCCGG - Exonic
1075255583 10:120923818-120923840 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1077244308 11:1528706-1528728 GCGGAGCCAGAGGCAGGTGCGGG + Intergenic
1078360266 11:10662582-10662604 GCGGAGCCAGAGGGGCTGGTGGG - Intronic
1078795785 11:14591056-14591078 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1078891297 11:15560917-15560939 GCGGAGGGAGAGGCGCCGGCAGG + Intergenic
1080195235 11:29600513-29600535 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1081428342 11:42949870-42949892 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1082734888 11:56845191-56845213 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1083342384 11:61967250-61967272 GCGGTTCCCGGGGCGCGCGCTGG - Intronic
1083551519 11:63593659-63593681 GCGGAGGCTGAGGCACGAGCAGG - Intronic
1083709448 11:64539129-64539151 GCGGAGCCAGAGGGGGGCGGGGG + Intergenic
1084107372 11:66988799-66988821 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1085375846 11:76060558-76060580 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1085474793 11:76783162-76783184 GCGGAGCCTGAGCCGAGCCCGGG - Intronic
1086001122 11:81987042-81987064 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
1086210156 11:84308902-84308924 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1087094575 11:94306846-94306868 GCAGAGCCAGAGGCCCCTGCTGG + Intronic
1087318827 11:96635822-96635844 GCGGAGGGAGAGGCTCGGGCAGG + Intergenic
1089045935 11:115502900-115502922 GCGGAGCCCCAGGCCCGGGCGGG - Intronic
1089564631 11:119364215-119364237 GCGGGGCCCGAGGCGCCGGCGGG - Intronic
1089800201 11:121021653-121021675 GTGGAGGGAGAGGCGCGAGCTGG + Intergenic
1090229184 11:125089491-125089513 GTGGAGCGAGAGGCGCGAGCGGG + Intronic
1090479966 11:127059366-127059388 ACGGAGCCGGAGGCTCGCTCTGG + Intergenic
1091616539 12:2054194-2054216 GGGGAACCAGAGGGGCGCGCTGG - Intronic
1092133927 12:6132611-6132633 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1092135168 12:6142190-6142212 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1092142144 12:6191237-6191259 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1092272889 12:7037419-7037441 GTGGAGGGAGAGGCGCGAGCCGG + Intronic
1092366512 12:7881273-7881295 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1092471731 12:8787260-8787282 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1092732435 12:11547286-11547308 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1093266236 12:17007618-17007640 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1093527127 12:20115596-20115618 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1093581050 12:20784147-20784169 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1093652513 12:21661523-21661545 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1094327527 12:29256637-29256659 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1094385488 12:29888978-29889000 GTGGAGAGAGAGGCGCGGGCGGG - Intergenic
1095123059 12:38441946-38441968 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1095533941 12:43224316-43224338 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1097490906 12:60269735-60269757 GTGGAGACAGAGGCGCGGGCGGG + Intergenic
1097938571 12:65279158-65279180 GCGGGGCGAGAGGCTCCCGCGGG - Intronic
1098759202 12:74402940-74402962 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1099192409 12:79573912-79573934 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1099443806 12:82728765-82728787 GTGGAGGCAGAGGCGTGGGCAGG + Intronic
1099716265 12:86296759-86296781 GTGGAGGGAGAGGCGCGAGCAGG - Intronic
1099790674 12:87330209-87330231 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1100078883 12:90824056-90824078 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1100142302 12:91633938-91633960 GCGGAGGGAGAGGCACGGGCAGG + Intergenic
1100166654 12:91924256-91924278 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1100600607 12:96108898-96108920 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1101008949 12:100430295-100430317 GTGGAGAGAGAGGCGCGAGCGGG + Intergenic
1101603814 12:106233026-106233048 GCGGAGGGAGAGGCACGGGCGGG + Intergenic
1102309717 12:111835648-111835670 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1102387272 12:112520256-112520278 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
1102997534 12:117361490-117361512 GGTGAGCCAGGGGCGCGCGCGGG - Exonic
1103146186 12:118597542-118597564 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1103459696 12:121093874-121093896 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1103668504 12:122592018-122592040 GTGGAGGGAGAGGCGCGAGCAGG + Intronic
1103783437 12:123414480-123414502 GTGGAGGGAGAGGCGCGAGCGGG - Exonic
1104614558 12:130257021-130257043 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1104882769 12:132084128-132084150 GCGGAGCCAGAGGCGCGCGCCGG + Intergenic
1105883451 13:24623351-24623373 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1107590504 13:41898946-41898968 GTGGAGGAAGAGGCGCGAGCGGG - Intronic
1107605210 13:42049158-42049180 GCGGGGCCTGGGGCGCGGGCGGG + Intronic
1108435301 13:50396588-50396610 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1108751570 13:53452759-53452781 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1108856558 13:54800045-54800067 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1109149273 13:58823932-58823954 GCGGAGGCAAAGGCGCGGGAGGG - Intergenic
1109152155 13:58859221-58859243 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1109446651 13:62448265-62448287 GTGGAGCGAGAGGCGCCAGCGGG - Intergenic
1109563197 13:64077861-64077883 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1109638125 13:65149924-65149946 GTGGAGGCAGAGGCGCGGGCGGG - Intergenic
1109858792 13:68170973-68170995 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1110024107 13:70512272-70512294 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1110572975 13:77026700-77026722 GCGGGGGCCGGGGCGCGCGCGGG - Intronic
1110854238 13:80278985-80279007 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
1110862094 13:80355540-80355562 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1110874407 13:80490928-80490950 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1110913967 13:80998795-80998817 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1111556210 13:89884193-89884215 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1111672556 13:91348325-91348347 CCGGGGCCCGGGGCGCGCGCGGG + Intergenic
1112077794 13:95931803-95931825 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1112226462 13:97545270-97545292 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1112613057 13:100975690-100975712 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1112705816 13:102068468-102068490 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1113482724 13:110633396-110633418 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1113506599 13:110821153-110821175 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1113538174 13:111084239-111084261 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1113678017 13:112221710-112221732 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1113888695 13:113725254-113725276 GCGGACCCAGGGGCGTGCACAGG + Intronic
1114490042 14:23094842-23094864 GCGGATCCAGAGGCTCGCGCTGG + Exonic
1115458759 14:33635516-33635538 GCAGACCCAGAGGCTCGAGCAGG + Intronic
1116325765 14:43533022-43533044 GTGGAGGGAGAGGCGCGCGTGGG + Intergenic
1117565604 14:56991060-56991082 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1117742588 14:58833923-58833945 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1118215406 14:63803629-63803651 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1118306296 14:64658172-64658194 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1118592491 14:67411932-67411954 GCGGGGCCAGACGCGCGCCCCGG - Intronic
1118932330 14:70254714-70254736 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1118994221 14:70822231-70822253 GGAGAGAGAGAGGCGCGCGCTGG - Intergenic
1119027747 14:71167533-71167555 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1119027982 14:71168885-71168907 GAGGTGCCAGAGGCGCCAGCTGG - Intergenic
1119038800 14:71254289-71254311 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1119303715 14:73590800-73590822 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1119330135 14:73787298-73787320 GCGGAGCCGGGGGCGCGGGCGGG - Intronic
1119673489 14:76537117-76537139 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1119870738 14:78014348-78014370 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1120844124 14:89111641-89111663 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1121506719 14:94483323-94483345 GCGGTGCCAGTGGCGCTGGCAGG - Intergenic
1122625643 14:103084218-103084240 GCGGAGCCAGCGGAGCGCGGAGG + Intergenic
1122960979 14:105093524-105093546 GCGGGGCCCGGGGCGCGGGCCGG - Intergenic
1202918371 14_KI270723v1_random:6020-6042 GCGGAGCCACAGGGGCGCGCGGG - Intergenic
1125112174 15:36046947-36046969 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1125565792 15:40677294-40677316 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1125609662 15:40961611-40961633 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1125674355 15:41494432-41494454 GCGGGGCCAGCGCCGGGCGCGGG + Intronic
1126165566 15:45651371-45651393 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1127071175 15:55289681-55289703 GAGGAGCGGGAGGCGCGCGGCGG - Intronic
1127103335 15:55588546-55588568 TTGGAGCAAGAGGCGCGCGCGGG - Intronic
1128110807 15:65075018-65075040 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1128322582 15:66703538-66703560 TCGGAGCCAGGGGCCGGCGCTGG + Exonic
1129280434 15:74480711-74480733 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1129724428 15:77894339-77894361 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
1130162333 15:81414035-81414057 GCGGAGGCAGAAGCGTGGGCGGG + Intergenic
1130538225 15:84802184-84802206 GCAGAGCCAGAGGAGGGCTCCGG + Exonic
1131257310 15:90871346-90871368 GCGGGGCCTGAGGGACGCGCCGG + Intronic
1132097672 15:99000043-99000065 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1132482324 16:172777-172799 GCGGAGCCCGGGGCGCGGCCTGG - Intergenic
1132483172 16:176581-176603 GCGGAGCCCGGGGCGCGGCCTGG - Intergenic
1132491603 16:234816-234838 GCGGGGCCAGCGGCGCGGTCGGG + Exonic
1132510981 16:341260-341282 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1132525413 16:411737-411759 GCTGAGCAGGAGGCGGGCGCTGG + Intronic
1132897804 16:2237193-2237215 GCGGAGACAGGGGCCCGCTCAGG - Intronic
1132900433 16:2251315-2251337 GTGGAGCCGGACGCGGGCGCAGG - Exonic
1133032946 16:3020366-3020388 GCGCAGACAGCGGCGGGCGCAGG + Exonic
1133209217 16:4253834-4253856 GCGGGGCCAGACGTGCGTGCTGG + Intergenic
1135280809 16:21152591-21152613 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1135299430 16:21313147-21313169 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1135335864 16:21600093-21600115 GCGGAACAAAAGGCGCTCGCGGG - Intronic
1135712630 16:24730155-24730177 GCTGCGGCAGAGGCTCGCGCCGG - Intronic
1135751108 16:25059277-25059299 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1136220022 16:28822971-28822993 GCGGAGAGGGAGGAGCGCGCGGG - Intergenic
1136228981 16:28876135-28876157 GCTGAGCCAGAGGCGCCCTCGGG - Intergenic
1136362604 16:29790608-29790630 GGGGACCCGGAGGCGAGCGCTGG + Intergenic
1136408865 16:30065151-30065173 GCGGAACTAGCGGCGCGCGGAGG - Intronic
1138693643 16:58791152-58791174 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1139125579 16:64072694-64072716 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1139442277 16:66974274-66974296 GCGGAGGGAGAGGGGCGGGCAGG + Exonic
1140156018 16:72427439-72427461 GCTGAGCCAGGGGCAGGCGCTGG + Intergenic
1141465778 16:84204948-84204970 GTGGAGGGAGAGGCGCGAGCCGG - Intergenic
1141837680 16:86553423-86553445 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1142596309 17:1031625-1031647 GCGGCCCCAGAGCCGGGCGCCGG + Intronic
1142638326 17:1271103-1271125 GCCGTGCCAGGGGCGCGTGCGGG - Exonic
1142671866 17:1491324-1491346 GCGGGGCCCGAAGGGCGCGCAGG + Intronic
1143128019 17:4656875-4656897 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1143135297 17:4709407-4709429 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1143223723 17:5282600-5282622 GCGGCGGCAAGGGCGCGCGCAGG + Intronic
1143664316 17:8347486-8347508 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1143830163 17:9645150-9645172 GCGTGGTGAGAGGCGCGCGCTGG - Intronic
1144128046 17:12220896-12220918 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1144527214 17:16000065-16000087 GCGGGGACAGGGGCGCGGGCCGG + Intronic
1144723176 17:17486347-17486369 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1144804699 17:17956836-17956858 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1145094805 17:20016460-20016482 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1146789007 17:35741308-35741330 GTGCAGCCCGAGGGGCGCGCAGG - Exonic
1147683935 17:42276082-42276104 GCTGGGCGAGGGGCGCGCGCGGG - Intronic
1147954218 17:44123388-44123410 GCGGAGCGCGGCGCGCGCGCTGG + Intronic
1148016827 17:44527959-44527981 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1148023339 17:44568211-44568233 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1148366217 17:47057649-47057671 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1148437117 17:47693822-47693844 GCGGCGCCAGCGGCCCGCGCTGG - Intergenic
1150772242 17:68051867-68051889 GTGGAGAGAGAGGCGCGAGCGGG + Intergenic
1150786785 17:68169723-68169745 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
1150804646 17:68309276-68309298 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1151782716 17:76258015-76258037 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1151812544 17:76453014-76453036 GCCGAGTCCGAGGCGGGCGCCGG + Exonic
1151983210 17:77526404-77526426 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1152751766 17:82065634-82065656 TCGGAGCCAAAGGCGCGCGGCGG - Intronic
1153299455 18:3580550-3580572 GCAGAGCCAGAGGAGGGCTCCGG + Intronic
1156038628 18:32794569-32794591 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1156150311 18:34233952-34233974 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1156863622 18:41865751-41865773 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1156943135 18:42795242-42795264 GTGGAGGGAGAGGCGCGAGCAGG + Intronic
1157085930 18:44580727-44580749 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1157610099 18:48950606-48950628 CCGGAGGCCGGGGCGCGCGCGGG + Exonic
1157935217 18:51864736-51864758 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1157979840 18:52367270-52367292 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1158351878 18:56572284-56572306 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1158697300 18:59714458-59714480 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1159167992 18:64725996-64726018 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1159230754 18:65605248-65605270 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1159322185 18:66866694-66866716 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1159670244 18:71212844-71212866 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1160176663 18:76600496-76600518 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1160198512 18:76777239-76777261 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1160791616 19:926098-926120 CGGGAGCCAGCGGCGCGCACCGG + Intronic
1160860964 19:1237119-1237141 CCGGAGCGAGAGGAGCGCACAGG + Intronic
1161461573 19:4400598-4400620 ACGGGGCCGGGGGCGCGCGCGGG - Intergenic
1162091128 19:8280719-8280741 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1162093362 19:8295557-8295579 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1162106958 19:8375754-8375776 GTGGAGGGAGAGGCGCGAGCCGG + Intronic
1162262086 19:9541690-9541712 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1162398398 19:10430931-10430953 GCGGGGCCAGGGGCTCGGGCAGG - Intronic
1162577153 19:11505731-11505753 GCGGAGGCTGAGGCGGGCGCGGG - Exonic
1162632740 19:11941661-11941683 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1163085863 19:14979537-14979559 GCGCAGGCCGAGGCGCGGGCAGG - Intronic
1163181764 19:15609011-15609033 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
1164144065 19:22499355-22499377 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1164212277 19:23109651-23109673 GGGGAGCCTGAGGCGGGCTCAGG - Intronic
1164270630 19:23668893-23668915 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1164975754 19:32571582-32571604 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1165036352 19:33036633-33036655 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1165846549 19:38821491-38821513 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1166979454 19:46624077-46624099 GCGAAGGCCGAGGGGCGCGCCGG + Exonic
1168315191 19:55481985-55482007 GCGGGGCGGGAGGCGCGGGCGGG - Exonic
925342695 2:3148095-3148117 GCGGAGCCGCAGGCGCCCACAGG + Intergenic
927137390 2:20106894-20106916 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
927472373 2:23385756-23385778 CCGGGGCCGGAGCCGCGCGCCGG + Exonic
927777768 2:25915495-25915517 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
927900393 2:26814465-26814487 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
928493046 2:31803713-31803735 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
928549432 2:32357000-32357022 GCGGGGCCCGGGGCGCGGGCTGG - Intergenic
928936856 2:36688255-36688277 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
929201817 2:39244269-39244291 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
929313608 2:40452272-40452294 GGGGAGCCCAAGGGGCGCGCAGG - Intronic
931708653 2:64968998-64969020 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
932494166 2:72138326-72138348 GCGGAGGCAGAGGCGCAGGCTGG + Intronic
932521736 2:72421822-72421844 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
933487298 2:82938811-82938833 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
934085088 2:88503132-88503154 GTGGAGGGAGAGGCGCGGGCCGG + Intergenic
934678467 2:96266062-96266084 GCAGAGCCGGCGGCGCGCCCAGG - Intergenic
934966862 2:98731133-98731155 GCGGAGCCGGCGGGGCGGGCGGG - Intergenic
935237590 2:101151451-101151473 GCGGGGCCAGGGGCGGGTGCGGG - Intronic
935397048 2:102619875-102619897 TCGGAGGCAGTGGCGCCCGCAGG - Exonic
935896896 2:107747705-107747727 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
936346844 2:111681844-111681866 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
937208567 2:120252823-120252845 GCGACGCCGGAGGCGCGCTCGGG + Exonic
937675582 2:124586402-124586424 GCGGAGCCAGGAGCGGGTGCTGG + Intronic
937711891 2:124987777-124987799 GTGGAGGGAGAGGCGCGAGCCGG - Intergenic
937716279 2:125037329-125037351 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
937746559 2:125422240-125422262 GCGGAAGGAGAGGCGCGAGCGGG + Intergenic
937993269 2:127675471-127675493 GCGCGGCCAGCGGCGGGCGCGGG + Intronic
938126121 2:128672491-128672513 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
938400988 2:130991441-130991463 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
938931237 2:136088389-136088411 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
939229716 2:139410335-139410357 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
939275249 2:139991065-139991087 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
941240041 2:163026268-163026290 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
941309746 2:163913606-163913628 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
941476629 2:165957434-165957456 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
943494796 2:188606760-188606782 GTGGAGGAAGAGGCGCGAGCCGG - Intergenic
943646074 2:190408651-190408673 GCGGAGACAGCGGCGCACGCTGG - Intronic
943680392 2:190761330-190761352 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
943790015 2:191921651-191921673 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
944228392 2:197370566-197370588 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
944482766 2:200174778-200174800 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
944728557 2:202496904-202496926 GTGGAGGGAGAGGCGCGAGCAGG + Intronic
944904813 2:204251922-204251944 GCCGAGGCAGAGGCTCGAGCTGG + Intergenic
945069611 2:205977224-205977246 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
945907928 2:215615252-215615274 GAGGAGGGAGAGGCGCGGGCAGG - Intergenic
946152802 2:217787622-217787644 GTGGAGAGAGAGGCGCGGGCAGG - Intergenic
946362824 2:219229355-219229377 GCGCAGACGGGGGCGCGCGCGGG - Exonic
946376469 2:219312814-219312836 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
946418619 2:219552703-219552725 GCGGAGCCCGGGGCGTGAGCGGG + Intronic
946923606 2:224604068-224604090 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
946982210 2:225229815-225229837 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
947026588 2:225744123-225744145 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
947720383 2:232366334-232366356 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
947741388 2:232486564-232486586 GCGGCGCGGGGGGCGCGCGCGGG - Exonic
947856172 2:233326076-233326098 GGGGAGCCAGAGGAGGGCACCGG - Intronic
948449158 2:238058224-238058246 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
948755223 2:240155527-240155549 GGGGAGTCAGAGGCGCTTGCTGG + Intergenic
1169849549 20:10034877-10034899 GCGGAGGCGGAGGCGGGGGCGGG + Intronic
1170989845 20:21291868-21291890 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1170999433 20:21397421-21397443 GGGGGGCCTGGGGCGCGCGCCGG + Exonic
1172130715 20:32652960-32652982 GCTCAGCCAGAGGAGCGGGCTGG + Intergenic
1172431900 20:34899169-34899191 GCGGAGGGAGAGGCCCGAGCGGG - Intronic
1173195566 20:40910836-40910858 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1173195647 20:40911177-40911199 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1173738286 20:45377403-45377425 GCGGAGCCAGAGGCAGGCAGGGG - Intronic
1174298896 20:49568194-49568216 GCGGAGTGGGAGGGGCGCGCCGG - Intergenic
1175210024 20:57348390-57348412 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1175421929 20:58840192-58840214 GGAGAGCCAGAGGAGCGCGGTGG - Intronic
1175877735 20:62238457-62238479 GCGCAGCGAGTGGCGGGCGCGGG + Intronic
1176096716 20:63347676-63347698 GCAGAGCCAGAGACGCGGGACGG - Intronic
1176549963 21:8216890-8216912 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
1176568889 21:8399924-8399946 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
1176576803 21:8444159-8444181 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
1177795868 21:25778361-25778383 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1178259815 21:31088569-31088591 GTGGAGGAAGAGGCGCGGGCGGG - Intergenic
1178334538 21:31731807-31731829 GCGGAGTCCGAGGCCCGGGCAGG + Exonic
1178585684 21:33868683-33868705 GTGGAGGGAGAGGCGCGAGCAGG - Intronic
1180741088 22:18053723-18053745 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1180852817 22:19029969-19029991 GCGGCGGCAGCAGCGCGCGCAGG - Intergenic
1180949462 22:19714656-19714678 GCGGGGACAAAGGCGCGCGCGGG - Intronic
1181077699 22:20392723-20392745 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1181094363 22:20495641-20495663 GCGGAGTCCGAGGGGCGCGGGGG - Intronic
1181162133 22:20965353-20965375 GCGGGGCCAGAGGCACTGGCCGG + Intronic
1181800917 22:25347273-25347295 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1183422165 22:37718206-37718228 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1183685172 22:39357531-39357553 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1184562105 22:45269256-45269278 GCGGAGGCGGAGGCGGGGGCGGG + Intergenic
1184584215 22:45436722-45436744 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1184664175 22:45978673-45978695 TCGCAGCCAGTGGCGGGCGCGGG + Intergenic
1184902592 22:47457072-47457094 GCGGGGCCAGAGGCGAGGCCAGG - Intergenic
1184906293 22:47488673-47488695 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1185313847 22:50170500-50170522 GAGTAGCCGGAGGCGCGCGGCGG - Intergenic
1203254853 22_KI270733v1_random:133216-133238 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
1203262909 22_KI270733v1_random:178295-178317 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
950601193 3:14037192-14037214 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
950710606 3:14810705-14810727 GCGGAGTCCGAGGCGCGCCGGGG + Intergenic
952393672 3:32902788-32902810 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
952398194 3:32939677-32939699 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
952730599 3:36633901-36633923 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
952795205 3:37232998-37233020 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
953002847 3:38951146-38951168 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
953069095 3:39502332-39502354 GCGGAGCGGGAGGGGCGTGCTGG - Intronic
953522531 3:43656792-43656814 GTGGAGGGAGAGGCGCGAGCAGG - Intronic
954620080 3:51990551-51990573 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
954632749 3:52056161-52056183 GAGGAGCTGGAGGCGCGCGGCGG - Exonic
954778882 3:53045362-53045384 GCGGAGCGCGGGGCGCGCGCGGG + Intronic
955186384 3:56718928-56718950 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
955266496 3:57449712-57449734 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
955449446 3:59050852-59050874 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
956195706 3:66651565-66651587 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
956479585 3:69660661-69660683 GTGGAGACAGAGGCGCAGGCGGG + Intergenic
956481419 3:69677447-69677469 GTGGAGAGAGAGGCGCGAGCGGG + Intergenic
957009224 3:74985492-74985514 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
957209467 3:77240450-77240472 GTGGAGGGAGAGGCGCGGGCAGG - Intronic
957556337 3:81767753-81767775 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
957560200 3:81812349-81812371 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
957630908 3:82715324-82715346 GTGGAGGAAGAGGCGCGGGCGGG + Intergenic
959422701 3:106148621-106148643 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
960282094 3:115791556-115791578 GTGGAGGGAGAGGCGCGAGCTGG + Intergenic
960669166 3:120140247-120140269 GTGGAGGTAGAGGCGCGGGCGGG + Intergenic
961268741 3:125671672-125671694 GCGGAGGGAGAGGCGCAGGCCGG + Intergenic
961461994 3:127056472-127056494 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
961688758 3:128653389-128653411 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
961754915 3:129121829-129121851 GCGGAGCCGGGGGCGGGCGGGGG - Intronic
962600546 3:136987953-136987975 GTGGAGGGAGAGGCGCGAGCTGG - Intronic
962758212 3:138484650-138484672 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
963397847 3:144756880-144756902 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
963440369 3:145333388-145333410 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
963862125 3:150322962-150322984 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
964014333 3:151928149-151928171 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
964118011 3:153156086-153156108 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
964375017 3:156041313-156041335 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
964378493 3:156073155-156073177 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
964443965 3:156740572-156740594 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
964771121 3:160225443-160225465 GAGGAGCCCGCGGCGCGCGGAGG - Intergenic
965044177 3:163552687-163552709 GTGGAGCGAGAGGCGCGAGCGGG - Intergenic
965200385 3:165649683-165649705 GTGGAGCGAGAGGCGCGAGCGGG - Intergenic
965245278 3:166258834-166258856 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
965287999 3:166842806-166842828 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
965446437 3:168780135-168780157 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
965943525 3:174212338-174212360 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
966096836 3:176213792-176213814 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
966372450 3:179263374-179263396 GGGGAGGGAGAGGCGCGGGCGGG - Intronic
966548995 3:181183353-181183375 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
966883267 3:184361615-184361637 GCTGCGCCAGCGGCGCCCGCCGG - Exonic
967171797 3:186827585-186827607 GCGGAGGCAGACGCTCGCGGAGG + Intergenic
967184158 3:186930923-186930945 GCGGGGCCCGCGGCGCGCGTAGG + Intronic
967499194 3:190177415-190177437 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
967718307 3:192789026-192789048 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
968181638 3:196599403-196599425 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
968556753 4:1249543-1249565 GCGGGGCGAGAAGCGAGCGCGGG - Intronic
968809531 4:2793580-2793602 GCGGGGCCAGAGGGGCGCGAGGG - Intronic
968831620 4:2935095-2935117 GCGGGGCCTCAGGCGAGCGCTGG + Intergenic
969113885 4:4859759-4859781 GAGGGGCGGGAGGCGCGCGCGGG + Exonic
969115031 4:4866021-4866043 CCAGAGGCGGAGGCGCGCGCGGG - Intergenic
969256908 4:6008394-6008416 GCGGACCCAGCGGCGCCAGCTGG - Intergenic
969330340 4:6470988-6471010 GCGGAGCCGGAGCCCCGCGGAGG - Intronic
969362315 4:6672718-6672740 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
969440701 4:7215123-7215145 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
969524378 4:7696750-7696772 GAGGAGCCAGAGGCAGGTGCAGG - Intronic
969655015 4:8491775-8491797 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
969814896 4:9679856-9679878 GCAGAGGGAGAGGCGCGGGCAGG + Intergenic
970649368 4:18159635-18159657 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
970673205 4:18418704-18418726 GTGGAGGGAGAGGCGCGAGCTGG - Intergenic
971563524 4:28112774-28112796 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
971709425 4:30092702-30092724 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
971905235 4:32716591-32716613 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
972022821 4:34336007-34336029 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
972344605 4:38182573-38182595 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
972751200 4:41990769-41990791 ACGGAGCCAGCGGCCAGCGCGGG - Intronic
973764347 4:54149665-54149687 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
973765134 4:54155489-54155511 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
974484828 4:62492262-62492284 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
974792804 4:66712779-66712801 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
975298780 4:72765893-72765915 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
975585070 4:75940918-75940940 GCGGACCGGGAGGCGCGCCCGGG - Exonic
975755837 4:77570659-77570681 GTGGAGGGAGAGGCGCGAGCAGG + Intronic
975994905 4:80302832-80302854 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
976846038 4:89490051-89490073 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
977206479 4:94169839-94169861 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
977717389 4:100196886-100196908 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
977751004 4:100609131-100609153 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
977810044 4:101347438-101347460 GGGGAGGCAGAGGCGAGCGCGGG - Exonic
977885801 4:102250652-102250674 GTGGAGGCAGAGGCGCGGGTGGG - Intergenic
978073154 4:104495160-104495182 GGGGAACAAGAGGCGCACGCGGG + Intergenic
978080148 4:104581766-104581788 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
978080179 4:104581872-104581894 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
978080210 4:104581978-104582000 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
978361083 4:107931703-107931725 GCAGCCCCAGAGGCGCACGCAGG - Exonic
978463651 4:108984718-108984740 GTGGAGGGAGAGGCGCGGGCAGG - Intronic
978466218 4:109012468-109012490 GTGGAGGGAGAGGCGCGGGCAGG + Intronic
978748535 4:112222439-112222461 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
978944772 4:114482047-114482069 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
978998092 4:115179782-115179804 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
979033252 4:115678808-115678830 GTGGAGGCAGAGGCGCGGGCGGG - Intergenic
979224150 4:118265543-118265565 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
979688545 4:123537912-123537934 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
979825744 4:125229955-125229977 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
980051973 4:128047924-128047946 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
980230289 4:130038908-130038930 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
980470267 4:133240774-133240796 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
981146816 4:141333559-141333581 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
981275782 4:142897494-142897516 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
982630218 4:157822001-157822023 GTGGAGGGAGAGGTGCGCGCGGG + Intergenic
982814622 4:159869400-159869422 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
983060299 4:163152840-163152862 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
983734677 4:171043164-171043186 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
983752806 4:171298269-171298291 GTGGAGCGAGAGGCGCGAGCGGG + Intergenic
984192877 4:176625529-176625551 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
984265616 4:177495587-177495609 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
984662213 4:182386555-182386577 GTGGAGGGAGAGGCGCGAGCAGG + Intronic
984901713 4:184591903-184591925 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
984948763 4:184990454-184990476 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
984966359 4:185143495-185143517 GCGGTGCAAGAGGCGGGCGCGGG + Intronic
985087058 4:186324579-186324601 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
985894986 5:2743534-2743556 GCGGAGCCGGGAGCGCGCCCAGG + Intergenic
986626125 5:9725303-9725325 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
986697959 5:10375153-10375175 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
986912430 5:12574310-12574332 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
987146290 5:14994171-14994193 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
987156832 5:15096921-15096943 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
987352316 5:17032758-17032780 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
987355821 5:17062226-17062248 GCGGAGGGAGAGGCGAGGGCGGG + Intergenic
987384052 5:17312138-17312160 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
987476737 5:18400037-18400059 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
987543788 5:19287739-19287761 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
987696564 5:21341390-21341412 GTGGAGGGAGAGGCGCGGGCCGG + Intergenic
987990283 5:25200388-25200410 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
988087027 5:26485645-26485667 GTGGAGGCAGAGGCGCGACCCGG - Intergenic
988722463 5:33892218-33892240 GCGGGGCCGGAGGAGCGCGGGGG - Intergenic
988755639 5:34245180-34245202 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
989777351 5:45225628-45225650 GTGGAGGAAGAGGCGCGGGCGGG + Intergenic
990345223 5:54865072-54865094 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
990461485 5:56035484-56035506 GTGGAGGGAGAGGCACGCGCGGG + Intergenic
991351205 5:65722153-65722175 GCGGGGCCAGACACGCGAGCTGG + Intronic
991567609 5:68020769-68020791 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
991743890 5:69710951-69710973 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
991753819 5:69844291-69844313 GTGGAGGGAGAGGCGCGGGCCGG + Intergenic
991795462 5:70290683-70290705 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
991803436 5:70401018-70401040 GTGGAGGGAGAGGCGCGGGCCGG + Intergenic
991823260 5:70586219-70586241 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
991833135 5:70719404-70719426 GTGGAGGGAGAGGCGCGGGCCGG + Intergenic
991887829 5:71290202-71290224 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
991967544 5:72107728-72107750 GCGCCCCCAGAGACGCGCGCTGG + Intronic
992866329 5:80960544-80960566 GCGGTGGCAGGGGCGCGGGCTGG - Intergenic
992947303 5:81823158-81823180 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
992947409 5:81823717-81823739 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
993202241 5:84830645-84830667 GTGGAGGGAGAGGCGCGCACAGG - Intergenic
993320971 5:86467046-86467068 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
993328618 5:86569889-86569911 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
993821995 5:92631328-92631350 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
994096300 5:95851160-95851182 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
994254829 5:97580358-97580380 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
994509879 5:100689232-100689254 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
994701741 5:103142403-103142425 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
994928785 5:106154301-106154323 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
995206688 5:109488168-109488190 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
995326438 5:110894352-110894374 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
996298592 5:121954317-121954339 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
996478733 5:123949553-123949575 GTGGAGGCAGAGGCGCGGGCGGG - Intergenic
996815538 5:127569450-127569472 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
998569471 5:143244481-143244503 GAGGAGCCAGAGGCGGGAGCTGG - Intergenic
999406140 5:151309182-151309204 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1000085833 5:157886851-157886873 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1000212329 5:159119168-159119190 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1000329230 5:160194272-160194294 GTGGAGGGAGAGGCGCGAGCAGG - Intronic
1000609113 5:163355864-163355886 GTGGAGAGAGAGGCGCGGGCGGG + Intergenic
1002004673 5:176222390-176222412 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1002221704 5:177688230-177688252 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1002616408 5:180459167-180459189 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1003100152 6:3170761-3170783 GTGGAGTGAGAGGCGCGAGCGGG + Intergenic
1003200906 6:3959594-3959616 GCTGAGCCAGAGGTGTGTGCAGG + Intergenic
1003318886 6:5035433-5035455 GCTGAGCCAGAGGTGTGTGCAGG - Intergenic
1003506711 6:6746039-6746061 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1003508873 6:6762845-6762867 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1003578327 6:7317099-7317121 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1003593681 6:7456357-7456379 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1003671501 6:8164332-8164354 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1003747971 6:9024273-9024295 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1003770197 6:9290801-9290823 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1003824877 6:9942170-9942192 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1003845693 6:10171718-10171740 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1003862757 6:10337406-10337428 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1003947239 6:11087212-11087234 GTGGAGGAAGAGGCGCGCGCCGG + Intergenic
1003982506 6:11402947-11402969 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1003984009 6:11417360-11417382 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1004053192 6:12108755-12108777 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1004248425 6:14002421-14002443 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1004250277 6:14018030-14018052 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1004665563 6:17745672-17745694 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1004689131 6:17976553-17976575 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1004864115 6:19837231-19837253 GCGGAGGGAGAGGCGAGGGCGGG - Intergenic
1004864129 6:19837261-19837283 GCGGAGCCCGCTGGGCGCGCGGG - Intergenic
1004866093 6:19854791-19854813 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
1004906176 6:20239058-20239080 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1004914411 6:20318914-20318936 GTGGAGGAAGAGGCGCGGGCAGG + Intergenic
1005059249 6:21761154-21761176 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1005554277 6:26956955-26956977 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
1005600913 6:27425193-27425215 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1005758932 6:28950158-28950180 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
1006005741 6:31000485-31000507 GCGGAGGGAGAGGTGCGAGCGGG + Intergenic
1006033598 6:31195456-31195478 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1006127931 6:31852052-31852074 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1008005630 6:46406131-46406153 GTGGAGGGAGAGGCGCGAGCAGG - Intronic
1008038743 6:46774594-46774616 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1008270527 6:49483782-49483804 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1008284384 6:49629914-49629936 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1009402718 6:63275295-63275317 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1009746652 6:67825397-67825419 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1010199352 6:73269238-73269260 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1010277982 6:73990995-73991017 GTGGAGGGAGAGGCGCGGGCAGG - Intergenic
1011178096 6:84587427-84587449 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1011277440 6:85643764-85643786 GCGGAGCCGGGGGCGGGGGCCGG - Intronic
1012450541 6:99349447-99349469 GCGGGCTCAGAGGCGCGCGGAGG + Exonic
1012733570 6:102911005-102911027 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1012760542 6:103294768-103294790 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
1013025761 6:106269771-106269793 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1013694853 6:112689756-112689778 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1014055849 6:117014756-117014778 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1014718525 6:124891968-124891990 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1014874710 6:126643573-126643595 GCGGAGCCTGGGACGCACGCAGG - Intergenic
1015600307 6:134904726-134904748 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1016104763 6:140148485-140148507 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1016482356 6:144495508-144495530 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1017298945 6:152834339-152834361 GTGGAGGGAGAGGCGCGAGCTGG + Intergenic
1017537332 6:155363047-155363069 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1017581262 6:155867120-155867142 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1017839547 6:158210153-158210175 GTGGAGCAAGAGGCGCGAGCGGG - Intergenic
1018064276 6:160114866-160114888 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1018109434 6:160520632-160520654 GTGGAGCGAGAGGCGCGGGCGGG - Intergenic
1018624685 6:165765651-165765673 GGGGAGGGAGAGGCGCGAGCAGG - Intronic
1019000303 6:168744150-168744172 GCGGAGGGAGAGGCGCGAGCGGG - Intergenic
1019334625 7:477139-477161 GCGGCGCCAGCGGCCCGCGGGGG + Intergenic
1020210275 7:6153835-6153857 GAGGAGCCAGATGCGGCCGCCGG + Exonic
1021436618 7:20624843-20624865 GCGGAGCCTGAGGCGCCCAGAGG - Intronic
1022101794 7:27173525-27173547 GCCGAGCCGGAGGCTAGCGCGGG + Exonic
1022508823 7:30922591-30922613 GCGGAGCCAAAGGACCGAGCAGG - Exonic
1022750394 7:33218969-33218991 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1023127907 7:36973739-36973761 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1023181772 7:37492086-37492108 GTGGAGGGAGAGGCGCGGGCCGG + Intergenic
1024262372 7:47582054-47582076 GGGGAGCCTGAGGCGCGGTCCGG + Exonic
1024269037 7:47628472-47628494 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1024335677 7:48203281-48203303 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1024700675 7:51901260-51901282 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1024834006 7:53495016-53495038 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1025962109 7:66231705-66231727 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1026202911 7:68231044-68231066 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1026471143 7:70694704-70694726 GGGGAGACAGTGGCGAGCGCGGG + Intronic
1027579756 7:79977974-79977996 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1027665854 7:81042704-81042726 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1027868057 7:83673313-83673335 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1028198429 7:87934103-87934125 GCGCAGGCAAGGGCGCGCGCAGG - Intergenic
1028303327 7:89229093-89229115 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1028719459 7:94012232-94012254 GTGGAGGGAGAGGCGCGCGCGGG - Intergenic
1029407053 7:100381723-100381745 GTGGAGGGAGAGGCGCGGGCGGG + Intronic
1029567472 7:101348570-101348592 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1030659651 7:112206013-112206035 GCGGAGCGAGAGGGGCGCGGGGG + Intronic
1030780373 7:113593315-113593337 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1030819354 7:114077207-114077229 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1030820730 7:114087633-114087655 GCGGCGCCGGCGGCGCGGGCGGG + Intronic
1030950949 7:115790096-115790118 GTGGAGCGAGAGGCGCCTGCGGG - Intergenic
1031253170 7:119413693-119413715 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1031378757 7:121059965-121059987 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1031586193 7:123534645-123534667 GAGGAGCCAGAGGCGGGTGGGGG + Intronic
1031605557 7:123763536-123763558 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1032248036 7:130230017-130230039 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1033065048 7:138146159-138146181 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1033394122 7:140957309-140957331 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1034100392 7:148445590-148445612 GCGGAGGGAGAGGTGCGGGCAGG - Intergenic
1034167794 7:149039062-149039084 GTGGAGACAGAGGTGCGAGCGGG - Intergenic
1034956546 7:155338773-155338795 GCCGGGACAGAGGCGCGTGCAGG + Intergenic
1034967145 7:155398514-155398536 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1034978763 7:155462501-155462523 GCGGCGCCAGAGCCTGGCGCAGG + Exonic
1034985338 7:155509787-155509809 CCGGAGGGAGAGGGGCGCGCGGG - Intronic
1035463938 7:159063496-159063518 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1036123858 8:6045383-6045405 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1036441075 8:8781757-8781779 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1036554687 8:9848121-9848143 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1036701580 8:11016683-11016705 GCGGAGGCAGAGGCGGAGGCGGG - Intronic
1036914939 8:12796290-12796312 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1037957596 8:23071153-23071175 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1037971380 8:23174165-23174187 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1037983489 8:23272113-23272135 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1038038827 8:23707156-23707178 GCGGAATTTGAGGCGCGCGCTGG + Intergenic
1038267594 8:26048275-26048297 CCGGAGCCTGAGGAGCGCGTGGG - Intergenic
1038639364 8:29311460-29311482 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1039587580 8:38719860-38719882 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1040723085 8:50349913-50349935 GTGGAGTGAGAGGCGCGAGCCGG + Intronic
1042948793 8:74179882-74179904 GTGGAGAGAGAGGCGCGGGCAGG - Intergenic
1043129980 8:76447979-76448001 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1043149393 8:76694689-76694711 GCGGGGGCAGAGGCGGGGGCGGG - Intronic
1043346419 8:79303489-79303511 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1043435282 8:80231803-80231825 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1043640131 8:82441417-82441439 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1044302917 8:90606462-90606484 GTGGAGCGGGAGGCGCGGGCGGG - Intergenic
1045131978 8:99163765-99163787 GTGGAGGGAGAGGCGCGAGCGGG - Intronic
1045232367 8:100317151-100317173 GCGGAGGGAGAGGCGCGAGCGGG - Intronic
1045467801 8:102485877-102485899 GTGGAGAGAGAGGCGCGAGCGGG - Intergenic
1045678449 8:104633250-104633272 GTGGAGGGAGAGGCGCGGGCGGG - Intronic
1046208930 8:111041203-111041225 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1046621183 8:116531082-116531104 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1048244185 8:132775556-132775578 GCAGAGGCAGAGGCCCGGGCTGG + Exonic
1048576061 8:135690761-135690783 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1048655449 8:136530775-136530797 GTGGAGGGAGAGGCGCGGGCCGG - Intergenic
1049087679 8:140490880-140490902 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1049873805 8:145002587-145002609 GCGGAGGCAGCGGGGCGTGCAGG - Intergenic
1051439820 9:17072600-17072622 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1051549810 9:18315695-18315717 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1051892656 9:21959246-21959268 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1052313398 9:27092649-27092671 GTGGAGGGAGAGGCGCGGGCGGG + Intergenic
1052979505 9:34437919-34437941 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1054775626 9:69121581-69121603 GTGCAGCCAGCGACGCGCGCAGG + Intronic
1055925586 9:81507369-81507391 GTGGAGGGAGAGGCGCGGGCAGG + Intergenic
1056081009 9:83093672-83093694 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1056126100 9:83537819-83537841 GCGCAGTGAGACGCGCGCGCAGG + Intronic
1057294325 9:93826609-93826631 GCGGAGGCAGGGGCGGGCGGGGG + Intergenic
1057543900 9:96002085-96002107 GTGGAGGGAGAGGCACGCGCGGG - Intronic
1058174908 9:101724474-101724496 GCGGAGGGAGAGGCGCGAGCGGG - Intronic
1058663018 9:107283430-107283452 GCGGAGGCAGCGGCGCGGTCCGG + Exonic
1058786454 9:108393500-108393522 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1059791193 9:117643093-117643115 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1059810578 9:117852021-117852043 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1059891482 9:118809581-118809603 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1060389880 9:123268499-123268521 GAGGAGCCGGAGACGCGAGCGGG - Intronic
1060468723 9:123930129-123930151 GCGGAGGGGGCGGCGCGCGCCGG - Intronic
1060594273 9:124839088-124839110 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1061128201 9:128689727-128689749 GCGGGGCCCGGGGCGCGCGCGGG + Intronic
1061483786 9:130910115-130910137 GTGGAGGGAGAGGCGCGAGCGGG + Intronic
1061489854 9:130938881-130938903 GAGGAGAGAGAGGAGCGCGCCGG - Intronic
1061810156 9:133157702-133157724 GCAGAGCCAGAGGTGAGCCCAGG - Intronic
1062003528 9:134228432-134228454 GCTGAGCCAGAGGGGCGAGGTGG - Intergenic
1062461912 9:136665824-136665846 GCGGAGCGAGCGGGGCGCGCCGG + Intronic
1203471254 Un_GL000220v1:116361-116383 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
1203479075 Un_GL000220v1:160333-160355 AGGGAGCGAGCGGCGCGCGCGGG - Intergenic
1186152638 X:6690873-6690895 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1186496443 X:10015525-10015547 GCGGAGGAGGCGGCGCGCGCGGG + Intergenic
1187005886 X:15232097-15232119 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1187139004 X:16575448-16575470 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1188189486 X:27156999-27157021 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1188881771 X:35499270-35499292 GAGGAGGGAGAGGCGCGGGCGGG + Intergenic
1189331384 X:40146721-40146743 GCGAACCCCGAGGCGCCCGCAGG - Intronic
1189473658 X:41333322-41333344 GGGGAGCCGGCGGCGCGCGCAGG - Intergenic
1190414007 X:50163696-50163718 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1192186727 X:68952155-68952177 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1194204431 X:90995417-90995439 GCGGAGGGAGAGGTGCGGGCAGG + Intergenic
1195909640 X:109876224-109876246 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1196582653 X:117394675-117394697 GTGGAGGGAGAGGCGCGAGCAGG + Intergenic
1196762385 X:119211246-119211268 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1196781507 X:119387951-119387973 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1196794025 X:119488230-119488252 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1196827320 X:119751195-119751217 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic
1197340005 X:125255641-125255663 GTGGAGGGAGAGGCGCGAGCGGG + Intergenic
1197533812 X:127663336-127663358 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1198267447 X:135022456-135022478 GCGGAGCCAGCGCGGCGCGATGG - Exonic
1198664353 X:139004392-139004414 GTGGAGGGAGAGGCGCGAGCAGG - Intronic
1198872337 X:141188865-141188887 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1199831328 X:151551554-151551576 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1199831817 X:151555517-151555539 GTGGAGGGAGAGGCGCGGGCGGG - Intergenic
1200279224 X:154762779-154762801 GCGGAATCCGAGGCGCCCGCTGG - Exonic
1200474101 Y:3623463-3623485 GTGGAGGGAGAGGCGCGAGCGGG - Intergenic
1200550272 Y:4570858-4570880 GCGGAGGGAGAGGTGCGGGCAGG + Intergenic
1201982663 Y:19924082-19924104 GTGGAGGGAGAGGCGCGAGCAGG - Intergenic