ID: 1104882915

View in Genome Browser
Species Human (GRCh38)
Location 12:132084616-132084638
Sequence GAGTGTTCACTGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104882915_1104882929 19 Left 1104882915 12:132084616-132084638 CCCACCTCCCTCAGTGAACACTC 0: 1
1: 0
2: 1
3: 14
4: 197
Right 1104882929 12:132084658-132084680 GCAAACGCCCACCCATCCCTCGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104882915 Original CRISPR GAGTGTTCACTGAGGGAGGT GGG (reversed) Intronic
901052078 1:6430270-6430292 GGGTGAGCACTGAGGGAGGAAGG + Intronic
905781679 1:40716306-40716328 GGGTGTAGACTCAGGGAGGTAGG + Intronic
906462052 1:46042152-46042174 GAGTGTTGACTGATGGGTGTGGG + Exonic
907523141 1:55038200-55038222 GGGTGTGTTCTGAGGGAGGTGGG - Intergenic
908403017 1:63788565-63788587 GAGGGTTTTCTGAAGGAGGTGGG + Intronic
910106764 1:83639632-83639654 GTGTGTTCACTGTTGGAGATAGG + Intergenic
910803753 1:91170524-91170546 GAGTGTTGTCTGGGGGAGATGGG - Intergenic
913134766 1:115877692-115877714 GCGTGTGCACTGGGGGAAGTGGG + Intergenic
914322099 1:146575084-146575106 AAGTGTTAATTCAGGGAGGTTGG - Intergenic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
916415118 1:164585250-164585272 GAATTTTCACTAAGGGAGGAGGG - Intronic
918731410 1:188001830-188001852 GGGGATTCAGTGAGGGAGGTTGG - Intergenic
923848313 1:237762880-237762902 GAGTGATGACTGAGGAAGGGAGG - Intronic
923855323 1:237839334-237839356 GAGTGGTCATTCAGGGAGCTGGG - Intergenic
924470673 1:244340166-244340188 GAGCATACACTGAGGGAGGGAGG - Intergenic
1066997833 10:42580006-42580028 GTGTATTCACTGATGGAGGAAGG + Intronic
1068099059 10:52529171-52529193 GAGGGTTCCCTGAGGCAGCTGGG - Intergenic
1069501305 10:68955670-68955692 GAGCGTTCACTGTGTCAGGTAGG - Intergenic
1069724366 10:70567668-70567690 AAGGGTGCACTGAGGGTGGTGGG + Exonic
1070732122 10:78837274-78837296 GAGGGTTGACTGATGCAGGTTGG - Intergenic
1071123820 10:82311589-82311611 GAATGTTCAGTGTGGCAGGTAGG + Intronic
1075302782 10:121340381-121340403 GAGAGGCCACTGAGGGGGGTTGG - Intergenic
1075850407 10:125581761-125581783 AAGTGGTCACTGGGGGATGTAGG + Intronic
1079305703 11:19319473-19319495 GAGTATTAAGTGTGGGAGGTAGG + Intergenic
1081828649 11:46085399-46085421 CAGTGATGACTGAGGGAGATAGG - Intronic
1082181909 11:49130221-49130243 GGGTGTTCTCTGAGGTAGGCTGG - Intergenic
1083397151 11:62399963-62399985 GAGAGTTCAGGGAAGGAGGTGGG - Intergenic
1084012790 11:66362049-66362071 GAATGTTCACAAAGGCAGGTGGG + Intronic
1084193875 11:67512321-67512343 CAGAGTTCCGTGAGGGAGGTGGG + Intergenic
1085333005 11:75668509-75668531 GGGTGCTCGCTGAGGGAGGAGGG - Exonic
1085400676 11:76233861-76233883 GAGTGTTCACGGAGTGAGGAGGG + Intergenic
1086683595 11:89704652-89704674 GGGTGTTCTCTGAGGTAGGCTGG + Intergenic
1088633050 11:111792621-111792643 GATTATGCACTGAGGGAGCTTGG - Intronic
1089627813 11:119762619-119762641 GAGTGTTCAATGTTGGGGGTGGG + Intergenic
1090727847 11:129543858-129543880 GAGCCTACACTGAGGGAGGGAGG + Intergenic
1090784124 11:130033314-130033336 GAGTCTTCTCTGGGGGAGGCGGG - Intergenic
1092137646 12:6160850-6160872 GAGTGTCCTCTGAGAGAGATGGG + Intergenic
1092739562 12:11614641-11614663 GAGGGTTTAGTGAGAGAGGTTGG + Intergenic
1097475799 12:60054263-60054285 AAGTGTTTACTGCTGGAGGTGGG + Intergenic
1098065703 12:66614041-66614063 GTGTGGTCAGTGAGGCAGGTGGG - Intronic
1099251168 12:80256809-80256831 GAGTGTTTTCTGAAAGAGGTGGG + Intronic
1099586898 12:84530153-84530175 GGGAGTTCACTGATGGTGGTGGG + Intergenic
1100187115 12:92150525-92150547 GAGGGTTCGGTGGGGGAGGTGGG + Intergenic
1101120378 12:101573170-101573192 GAGTGGTTACTGAGGGAGTAGGG + Intronic
1101577458 12:106011191-106011213 GAGTTTTCACTGAGGAAGACAGG + Intergenic
1102862694 12:116350297-116350319 GAGTGTTCAAAGATGAAGGTGGG - Intergenic
1103409845 12:120703141-120703163 AAGGGATAACTGAGGGAGGTAGG - Intergenic
1104882915 12:132084616-132084638 GAGTGTTCACTGAGGGAGGTGGG - Intronic
1107764767 13:43722348-43722370 AAATGTTCACAGAGGGATGTAGG + Intronic
1110613434 13:77514568-77514590 GAGTTCTCACAGAGGAAGGTAGG - Intergenic
1111160229 13:84384691-84384713 GTGTGTTCACTGGTGGTGGTGGG - Intergenic
1112402169 13:99086646-99086668 GAGTGGTCGCCGAGGGAGGCTGG - Intergenic
1113823599 13:113232773-113232795 GAGTGTACCCTGAGGGCTGTTGG + Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117447292 14:55816333-55816355 GAGGGCTCACAGAGGGAGCTGGG - Intergenic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1118658392 14:67979395-67979417 GAGTCTTCACTCTGGGTGGTGGG + Intronic
1121325107 14:93015294-93015316 GAGTCTGCACTGAGGGCTGTGGG + Intronic
1122053462 14:99075843-99075865 GAGTGTCCCCTGAAGGTGGTGGG - Intergenic
1122419244 14:101564840-101564862 GAGCGTTCGCGGAGGTAGGTAGG - Intergenic
1123470600 15:20549390-20549412 GAGCGGTGTCTGAGGGAGGTGGG - Intergenic
1123647460 15:22451310-22451332 GAGCGGTGTCTGAGGGAGGTGGG + Intergenic
1123730900 15:23144368-23144390 GAGCGGTGTCTGAGGGAGGTGGG - Intergenic
1123749039 15:23341794-23341816 GAGCGGTGTCTGAGGGAGGTGGG - Intergenic
1124281410 15:28365677-28365699 GAGCGGTGTCTGAGGGAGGTGGG - Intergenic
1124301292 15:28545944-28545966 GAGCGGTGTCTGAGGGAGGTGGG + Intergenic
1127925193 15:63532690-63532712 AAGTGTCCACTGTGGAAGGTAGG + Exonic
1128761300 15:70217769-70217791 GAGTGTTCAGTGACCCAGGTTGG + Intergenic
1128986276 15:72224048-72224070 GAGTGGTCTTTGAGGGAAGTAGG - Intronic
1129494088 15:75960204-75960226 GAGTGATTAATGAGGGAAGTAGG + Intronic
1130032827 15:80331984-80332006 GAGTGAACACTCAGGGAGGGCGG + Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1131133648 15:89916195-89916217 GAGTTGGCACAGAGGGAGGTAGG - Intergenic
1131585824 15:93691699-93691721 GAGGATTAACTGAGGGAGGAGGG + Intergenic
1132321439 15:100928444-100928466 CAGTGTTCCCTGAGTGAGGCTGG - Intronic
1136061082 16:27726887-27726909 GAGAGGTCCCAGAGGGAGGTGGG + Intronic
1136072416 16:27795840-27795862 GATTCTTCACTGAGGGAGGCGGG - Intronic
1139648933 16:68352056-68352078 GTTTGTTGACTGAGGGAGGGAGG + Intronic
1140011528 16:71136081-71136103 AAGTGTTAATTCAGGGAGGTTGG + Intronic
1141225872 16:82114412-82114434 GGTTGTTGACTGAGGCAGGTTGG + Intergenic
1142202630 16:88768379-88768401 GATTGTTCCCTGTGGGGGGTGGG + Intronic
1142218183 16:88840052-88840074 GAGTCCTCACACAGGGAGGTTGG - Intronic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142317191 16:89355215-89355237 GAGGGCTCACGGAGGGAGGGCGG + Intronic
1144053498 17:11517876-11517898 GAGTGGCCATTGATGGAGGTTGG - Intronic
1144435263 17:15234220-15234242 GTGTGTTCACTCAGGCAAGTGGG + Intronic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146978711 17:37139441-37139463 GACTGTTCACTGAGGCAAGAGGG + Intronic
1147021396 17:37536886-37536908 CAGTGTTCACTTAGAGAGATCGG - Intronic
1147459544 17:40559469-40559491 GAGTGTCTCCTGAGGGAGGTGGG + Intronic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1150501310 17:65653501-65653523 GCGTGTACTCTGAGGGAGGGTGG + Intronic
1150693183 17:67381884-67381906 GAGTGTTAAATGAGGGAGAAGGG - Intronic
1151491488 17:74434262-74434284 GAGGGTTCAAGGAGGGGGGTAGG - Intronic
1153011380 18:542762-542784 GAGTTTTCACTGTGGCATGTGGG - Intergenic
1157221586 18:45832071-45832093 GAGTGTGAACAGAGGGTGGTGGG - Intronic
1157671394 18:49531739-49531761 AATTGCTCACTCAGGGAGGTTGG - Intergenic
1157836815 18:50911500-50911522 GAGAGTTAACAGAGGGAAGTAGG + Intronic
1161164723 19:2780231-2780253 GAGTGTTCACAGAAGGTAGTGGG - Intronic
1161623176 19:5309966-5309988 GCGTTTACTCTGAGGGAGGTGGG - Intronic
1162965965 19:14156241-14156263 CAGTGCTCACTGAGGGAGGCAGG - Intronic
1165279272 19:34782817-34782839 GAGTTTTCCCTGAGGCAGGTGGG - Intergenic
1165977197 19:39686607-39686629 GAGTGTCCAGTGAGAGAGGAGGG - Intergenic
1166838090 19:45679569-45679591 GAGTGTCCACTGAGGGATGGGGG + Intronic
1167466628 19:49653708-49653730 GAGTGTCCCCTGGGGGAGGGTGG + Intronic
925096342 2:1207480-1207502 GAATGGACACTGAGGGAGGTTGG - Intronic
925199869 2:1958672-1958694 GGCTGTTCACTGTGAGAGGTGGG + Intronic
928204645 2:29275288-29275310 GATTTCACACTGAGGGAGGTGGG + Intronic
929686260 2:44037694-44037716 GACTGTTCATTGACGGAGGCAGG - Intergenic
930262623 2:49165302-49165324 GAGTGTTCACTGAGCTTGGGAGG + Intergenic
930661399 2:54058060-54058082 TATTGGTCCCTGAGGGAGGTAGG + Intronic
931616644 2:64165900-64165922 TAGTGAACACTGAGGGAGGTAGG - Intergenic
937497189 2:122433093-122433115 AATTATTCACTGAGGCAGGTGGG - Intergenic
937765558 2:125656760-125656782 GTGTGTTCAATGTGGGAGGTAGG - Intergenic
938392732 2:130917636-130917658 CTGTGTTCACTGGGGGAGGGGGG - Intronic
938804087 2:134789705-134789727 CAGGGTTCACTGAGGGCTGTTGG + Intergenic
939399504 2:141672364-141672386 GAGTGTTCACAAAGGGAAGAAGG + Intronic
940235975 2:151511195-151511217 TTGTGTTCACTGAGGGAGCCAGG - Intronic
941122367 2:161545654-161545676 TAGTGGTAACTGAGGGAGGCAGG + Intronic
944393855 2:199247527-199247549 GAGTGGTGAGTGAGAGAGGTTGG - Intergenic
946439635 2:219684537-219684559 AAGTATTAAATGAGGGAGGTAGG - Intergenic
947419392 2:229928575-229928597 CAATATTCAATGAGGGAGGTGGG - Intronic
1168850775 20:975433-975455 GTGTTTTGACTGAGGGAGGATGG - Intronic
1172448243 20:35004134-35004156 GACTATTCAGTGAGGGAGTTGGG + Intronic
1172506080 20:35463693-35463715 ATTTGTTGACTGAGGGAGGTTGG + Intronic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1177197883 21:17921903-17921925 GAGTGTTCACTGAGATAATTTGG - Intronic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
1181783376 22:25208573-25208595 GCTTGTTCTCTGAGGGAGGTGGG + Intergenic
1181987437 22:26810256-26810278 GAGTGTTCACTGAGAGCAGAAGG - Intergenic
1183479626 22:38056490-38056512 GTGGGTTCCCTGGGGGAGGTTGG - Intronic
953713377 3:45294394-45294416 GATTGTTCCATCAGGGAGGTGGG - Intergenic
954655947 3:52194408-52194430 GACTCATCACTGAGGCAGGTGGG + Intergenic
954701319 3:52452341-52452363 GAGAGGTCTCCGAGGGAGGTGGG - Intronic
954844011 3:53538953-53538975 GAGTGGTGACTGAGGGAAGTGGG - Intronic
960052663 3:113252832-113252854 GAGTGCTCAGGGAGGGAGGCAGG + Intronic
964305708 3:155337242-155337264 GACTGCTCACTGAGTGAGATTGG + Intergenic
965731300 3:171774840-171774862 AGGAGTTCACTGAGGGAGGCTGG + Intronic
968097980 3:195945620-195945642 GATTGTTCAGGGAGGGACGTGGG - Intergenic
968106446 3:196005003-196005025 GATTGTTCAGGGAGGGACGTGGG - Intergenic
968305195 3:197645926-197645948 GATTGTTCAGGGAGGGACGTGGG - Intergenic
968447650 4:660434-660456 GATTGTGGGCTGAGGGAGGTTGG - Intronic
969342129 4:6548895-6548917 CACTGTTCATTTAGGGAGGTGGG - Intronic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975306742 4:72858062-72858084 GAGTGTTAACAGAGGCATGTAGG - Intergenic
977238989 4:94543589-94543611 TGGTGGTCACTGATGGAGGTGGG - Intronic
978437019 4:108696533-108696555 GACTGTTCACTTAGTGAGGATGG + Intergenic
981104870 4:140868983-140869005 AAGGGTACACTGAGGTAGGTAGG + Intronic
981894561 4:149782881-149782903 GAGTGTCCAGTGAGGGTGGAAGG - Intergenic
985770795 5:1809403-1809425 GTGTGTTCACTGCCGGAGCTTGG + Intronic
988549399 5:32186508-32186530 GGGTCTTCACTGAAGGTGGTAGG - Intergenic
989139080 5:38184584-38184606 GAGTGTTCACTGAAGAAGATTGG - Intergenic
990512619 5:56502427-56502449 GAGTGTTCAGTGAGGGAGTGGGG + Intergenic
990662626 5:58034529-58034551 GAGTATTTTCTGTGGGAGGTGGG - Intergenic
991093599 5:62716594-62716616 AAGTCTTCTCTGAGGGAGGTGGG + Intergenic
991484779 5:67123657-67123679 AAGTGTTCACTGGAAGAGGTAGG - Intronic
999438300 5:151581443-151581465 GAGGGTTAGCTCAGGGAGGTAGG - Intergenic
1000064222 5:157681278-157681300 GAGAGGTTACTGAGGGAGGCAGG - Intergenic
1001417419 5:171555708-171555730 GAGTGTCCCCTGGTGGAGGTCGG - Intergenic
1002471895 5:179440414-179440436 GAGTCTTCAGTGTTGGAGGTGGG - Intergenic
1003535003 6:6969100-6969122 GAGGGTGCCCTGAGGGAGGGAGG - Intergenic
1003653541 6:7985132-7985154 ATTTGTTCTCTGAGGGAGGTTGG + Intronic
1004794638 6:19067636-19067658 GAGCGTTCAAGCAGGGAGGTTGG + Intergenic
1008895469 6:56548920-56548942 TAGTTTTCACTGAGTGAGTTAGG + Intronic
1012948834 6:105496009-105496031 CAGTTTTCAATGAGGCAGGTAGG - Intergenic
1013189341 6:107789076-107789098 GAGTGGCCACTGAGGGACATGGG - Intronic
1014266954 6:119289985-119290007 GAGTGTCCACTAAGGGTTGTTGG - Intronic
1018489104 6:164273342-164273364 GATTGTTCATTGAGGAATGTAGG + Intergenic
1022177218 7:27883072-27883094 AAGTGTGCACTGATGGATGTTGG + Intronic
1023709287 7:42974748-42974770 GCGTGGGCACAGAGGGAGGTTGG + Intergenic
1023840619 7:44095615-44095637 GATTGTTCTCTCTGGGAGGTGGG + Intergenic
1024059708 7:45688868-45688890 GAGTGTTAACTGATGGGGATGGG - Intronic
1024793361 7:52992732-52992754 GAGAGTGTCCTGAGGGAGGTAGG + Intergenic
1025888711 7:65624408-65624430 GAGAGTACAATGAGGGAGGGAGG - Intergenic
1029803637 7:102975214-102975236 GAGAGATCACTGAGGGAGAGGGG - Intronic
1031853740 7:126897556-126897578 GAGAGTACAATGAGGGAGGGAGG + Intronic
1032164046 7:129531857-129531879 GACTGTTTTCTGTGGGAGGTGGG - Intergenic
1033663246 7:143418215-143418237 GAATGTACACTCAGGGAGGGTGG - Intergenic
1033745482 7:144312263-144312285 GAGTGATCACTGGAGGAGCTGGG - Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036520328 8:9485661-9485683 GAGTGTTTACTAAGGGTGGGTGG + Intergenic
1038503365 8:28063555-28063577 GAGCGTGCCCTGGGGGAGGTGGG + Intronic
1040913585 8:52545500-52545522 GTGTGTGCAGGGAGGGAGGTGGG - Intronic
1041798644 8:61773569-61773591 AAGAGATCACTGAGCGAGGTGGG - Intergenic
1045799591 8:106087128-106087150 GATTGTGCACTCAGGGAGCTCGG - Intergenic
1046138603 8:110061888-110061910 GAGTATTCACTGAAGAAGGGAGG + Intergenic
1046718449 8:117592506-117592528 GATTGTTCACATAGTGAGGTCGG - Intergenic
1049165577 8:141123597-141123619 CAGTTTTCACTGGGGGAGCTGGG + Intronic
1053463438 9:38288142-38288164 GAGTGGCCACTGAAGGTGGTGGG + Intergenic
1055701730 9:78951602-78951624 GAGGGTACACTGAGCAAGGTAGG + Intergenic
1057053476 9:91943493-91943515 GGGTGCTCACTGAGGAAGGAGGG - Intronic
1057813750 9:98278908-98278930 GTGTGGGCACTGAGGAAGGTTGG - Intergenic
1057992080 9:99781109-99781131 AAGTGTTGATTGAGGGAGCTGGG - Intergenic
1058381173 9:104378732-104378754 GAGTGTGCACTGCAGGAAGTGGG - Intergenic
1058603738 9:106698334-106698356 GGGTGTACGGTGAGGGAGGTTGG + Intergenic
1058669867 9:107351758-107351780 GTGTGCTCACAGAGGGAGGATGG + Intergenic
1186415603 X:9380708-9380730 GAGTATTCTCTGAGGGACGAGGG + Intergenic
1190287520 X:48971130-48971152 GAGAGTTATCTGGGGGAGGTGGG + Exonic
1191209602 X:57871428-57871450 GAGTGCTCAGGGAGAGAGGTAGG - Intergenic
1191864559 X:65693487-65693509 GAGTAGTCAATGAGTGAGGTTGG + Intronic
1192220844 X:69196439-69196461 GAGAGTTCAGGGAGGGAGGGGGG - Intergenic
1192436731 X:71147866-71147888 GAGTGTTGACTGTGGGTGCTGGG - Exonic
1192699841 X:73457219-73457241 CAGTGTTCACTTAGGGTAGTGGG + Intergenic
1195551604 X:106177447-106177469 GATTGTTGCCTGAGAGAGGTGGG + Intronic
1197904725 X:131412739-131412761 GAGTGTTCAGTCAGTGGGGTGGG - Intergenic
1198294225 X:135270106-135270128 GAGGGAGCAGTGAGGGAGGTGGG + Intronic
1199456813 X:148038268-148038290 GAGTGTTGAATGAGGTAGGAGGG + Intergenic
1199512188 X:148634856-148634878 GAGTGTCCACTGGGTGAGGAAGG - Intronic
1199707733 X:150445303-150445325 GGGTGCTCAATGAGGGTGGTGGG + Intronic
1200152744 X:153959303-153959325 GAGTGGTCACTGGGGCGGGTGGG - Intronic
1202356611 Y:24058208-24058230 GCTTTTTCACTGAGGGAGTTAGG + Intergenic
1202514167 Y:25611901-25611923 GCTTTTTCACTGAGGGAGTTAGG - Intergenic