ID: 1104885521

View in Genome Browser
Species Human (GRCh38)
Location 12:132104859-132104881
Sequence GGGCGTCCTCTCGAAGCCCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 67}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104885521_1104885538 13 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885538 12:132104895-132104917 CCGGGGCTGGGGGCGCAGCGGGG 0: 3
1: 0
2: 8
3: 107
4: 930
1104885521_1104885536 12 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885536 12:132104894-132104916 CCCGGGGCTGGGGGCGCAGCGGG 0: 2
1: 0
2: 5
3: 126
4: 931
1104885521_1104885526 -4 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885526 12:132104878-132104900 GCCCGGCGTGCTGCTCCCCGGGG 0: 1
1: 1
2: 0
3: 15
4: 137
1104885521_1104885540 19 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885540 12:132104901-132104923 CTGGGGGCGCAGCGGGGTTTGGG 0: 2
1: 0
2: 1
3: 14
4: 172
1104885521_1104885534 11 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885534 12:132104893-132104915 CCCCGGGGCTGGGGGCGCAGCGG 0: 2
1: 0
2: 14
3: 113
4: 804
1104885521_1104885524 -6 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885524 12:132104876-132104898 ACGCCCGGCGTGCTGCTCCCCGG 0: 1
1: 1
2: 1
3: 6
4: 89
1104885521_1104885539 18 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885539 12:132104900-132104922 GCTGGGGGCGCAGCGGGGTTTGG 0: 2
1: 0
2: 3
3: 42
4: 401
1104885521_1104885532 3 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885532 12:132104885-132104907 GTGCTGCTCCCCGGGGCTGGGGG 0: 2
1: 0
2: 3
3: 30
4: 344
1104885521_1104885525 -5 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885525 12:132104877-132104899 CGCCCGGCGTGCTGCTCCCCGGG 0: 1
1: 1
2: 1
3: 9
4: 149
1104885521_1104885530 1 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885530 12:132104883-132104905 GCGTGCTGCTCCCCGGGGCTGGG 0: 2
1: 0
2: 1
3: 9
4: 184
1104885521_1104885529 0 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885529 12:132104882-132104904 GGCGTGCTGCTCCCCGGGGCTGG 0: 2
1: 0
2: 0
3: 24
4: 239
1104885521_1104885531 2 Left 1104885521 12:132104859-132104881 CCCTGGGCTTCGAGAGGACGCCC 0: 1
1: 1
2: 1
3: 8
4: 67
Right 1104885531 12:132104884-132104906 CGTGCTGCTCCCCGGGGCTGGGG 0: 2
1: 0
2: 3
3: 28
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104885521 Original CRISPR GGGCGTCCTCTCGAAGCCCA GGG (reversed) Exonic
902617551 1:17632109-17632131 GGGCCTCCTCTCGGAGGCCATGG - Intronic
904583681 1:31566735-31566757 GGGTGTCCTCCGGGAGCCCAGGG + Intergenic
912007549 1:104922937-104922959 GGGGGTCATCTCAACGCCCAGGG + Intergenic
915473532 1:156139407-156139429 GGGCTTCCTCTAGAAGCCAAGGG + Exonic
1063168904 10:3488084-3488106 GTGCCTCTTCTCGCAGCCCAGGG - Intergenic
1071471483 10:85987102-85987124 GGGCAGCCTCTCCATGCCCAGGG + Intronic
1074871012 10:117576071-117576093 GGAGGACCTCTGGAAGCCCAGGG + Intergenic
1075087249 10:119421931-119421953 GGGCGTCCCCTCCACCCCCAGGG + Intronic
1076003746 10:126931807-126931829 CTGCATCCTCCCGAAGCCCAGGG - Intronic
1076722248 10:132397756-132397778 GGGTGCCCTGTCGAAGGCCACGG + Intronic
1077093364 11:789352-789374 GGGAGTCCTCGCCCAGCCCAAGG + Intronic
1077317424 11:1925645-1925667 GGGCGTCCTGGCCAGGCCCAGGG - Intronic
1077733800 11:4766334-4766356 GGGCCACCTCTGCAAGCCCAAGG + Intronic
1081549125 11:44095978-44096000 GGGTGGCCTCTCGCAGCCCACGG - Intronic
1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG + Intronic
1101954024 12:109197985-109198007 GGGGATCATCTCGGAGCCCAGGG - Intronic
1104866972 12:131961491-131961513 GGGTGTCCTCTCGAAGCCCAGGG - Exonic
1104885521 12:132104859-132104881 GGGCGTCCTCTCGAAGCCCAGGG - Exonic
1114426753 14:22630277-22630299 GGGCTTCCTCTAGAGGCACAAGG + Intergenic
1121118534 14:91360672-91360694 GGGCCTTCTCTCCAAGCCCACGG - Intronic
1121997058 14:98611047-98611069 GGGCGTACACACGACGCCCAAGG - Intergenic
1122249159 14:100425921-100425943 CGGCGTCCTCGCAAGGCCCAGGG - Intronic
1122797575 14:104213754-104213776 GGGCATCCTCTCAACGCCCCAGG + Intergenic
1122951826 14:105049273-105049295 GGCTGTCCTCTGGAAGCCTAGGG + Intergenic
1132862886 16:2080169-2080191 GGGCGCCAACTCGAAGACCATGG - Exonic
1142140417 16:88470288-88470310 GGGCAGCCTCTGGATGCCCACGG + Intronic
1142896136 17:2980392-2980414 TGGCTTCCTCTCTCAGCCCAGGG + Intronic
1146983468 17:37188797-37188819 GGGCTTCCTCTTAAATCCCATGG - Intronic
1147179252 17:38674319-38674341 GGGCGTCCTCTCTGGGCCCGGGG - Exonic
1148291313 17:46452871-46452893 GGGTGTCCTCCCGAGGCCCCTGG + Intergenic
1148313500 17:46670574-46670596 GGGTGTCCTCCCGAGGCCCCTGG + Intronic
1151959912 17:77400459-77400481 GGGCGCCCTCTCTAAGCCACAGG - Intronic
1153227554 18:2909911-2909933 TGGCGTCCTCCCTGAGCCCACGG - Intronic
1153327879 18:3840345-3840367 GGGCGTCCTCTGGAGGCTCGAGG + Intronic
1153964326 18:10166467-10166489 AGGTGTCCTCTCCAGGCCCAAGG - Intergenic
1160204605 18:76822616-76822638 GGGCCGCCCCCCGAAGCCCAGGG + Intronic
1160799967 19:963220-963242 GGGCGTCCCCTCCCACCCCATGG + Intronic
1161997592 19:7723309-7723331 GGTCTTCCTCTCCCAGCCCACGG - Intergenic
1163554076 19:17982754-17982776 GGGCGTCCTCTCCGAGCCTCAGG + Intronic
1166503947 19:43360038-43360060 GGACGTCCTCTCACAGCCCTGGG - Intronic
925384497 2:3452613-3452635 GGAAGTCCTCTCGGAGCCCATGG - Intronic
944510191 2:200456809-200456831 GGGCATGCTCTCTAAACCCAGGG + Intronic
945906638 2:215601227-215601249 GGAAGTCCTCATGAAGCCCATGG - Intergenic
946398495 2:219455835-219455857 GGGCCTCCTCTCGGGGCGCACGG - Intronic
948163779 2:235845477-235845499 GGGTGTCCTCAGGAAGCCCAGGG - Intronic
1172134243 20:32676289-32676311 TGGCAGCCTCTGGAAGCCCAGGG + Intergenic
1174727121 20:52874548-52874570 AGGAGTCTTCTGGAAGCCCAGGG + Intergenic
1175973478 20:62698874-62698896 TGGTGTCCTCAGGAAGCCCAGGG + Intergenic
1185236040 22:49713647-49713669 GGGCGTCCTCCCTAATCCCAGGG + Intergenic
949431822 3:3985137-3985159 GGGCTTCATTTCAAAGCCCATGG - Intronic
949535868 3:4995748-4995770 GGGAGGCCTCACGAAGCCCTGGG - Intergenic
984549819 4:181146770-181146792 GGCCTTCCTCTCAAGGCCCAGGG - Intergenic
996570842 5:124930965-124930987 GGGCTTGCTCTAGAACCCCAGGG + Intergenic
999571680 5:152926080-152926102 GGGCGTGCTCCCAAAGCCTAGGG - Intergenic
1002102452 5:176864135-176864157 GGGCCACCTCTCTAGGCCCAAGG - Intronic
1006106700 6:31721219-31721241 AGGTGTCCTCTCGAAGACCTAGG - Intronic
1008497076 6:52144591-52144613 AGGCGTCCTCGCTCAGCCCAAGG + Intergenic
1018431498 6:163726199-163726221 TGGGGTCCTCTGGCAGCCCACGG + Intergenic
1019450621 7:1095868-1095890 GGGTGACCCCTCGATGCCCATGG - Intronic
1022527258 7:31046356-31046378 GGGTGACCTCTAGAAGCTCAGGG + Intergenic
1023530480 7:41148673-41148695 GGGCTTTCTCTCTAATCCCAGGG + Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024460987 7:49659086-49659108 GGGTGCCCTCTCCAATCCCACGG - Intergenic
1027685310 7:81273498-81273520 TGGTGTCCTCTTAAAGCCCAAGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1032547989 7:132759474-132759496 GGGCCTCCTCTCCAGGCCCTAGG - Intergenic
1041244982 8:55880605-55880627 CGGCGCCCTCTCGAGGCCCGCGG + Intronic
1049034210 8:140061875-140061897 GGGCCTGGTCTCCAAGCCCATGG - Intronic
1052969857 9:34370787-34370809 GGGCGTCCTGACCCAGCCCAGGG - Exonic
1055093968 9:72391027-72391049 GGGAGTCATCTCTAAGCCCTTGG + Intergenic
1058813680 9:108664774-108664796 GGGAGTCCTTTCCTAGCCCAGGG - Intergenic
1060749141 9:126157440-126157462 TGGCTGCCTCTCCAAGCCCAGGG - Intergenic
1060918260 9:127403851-127403873 GAGCTTCCTCCCCAAGCCCAGGG + Intronic
1062106218 9:134756471-134756493 TGGCGTCTTCTCGAAGCCCAGGG + Intronic
1062218086 9:135399866-135399888 GGGGGTGCTCTGGAAGCCCATGG + Intergenic
1198038216 X:132822325-132822347 GGGTGTCCTCTCTGAGACCACGG - Intronic