ID: 1104887435

View in Genome Browser
Species Human (GRCh38)
Location 12:132118932-132118954
Sequence CGCCTCCAGCTTGCACACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 105}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104887428_1104887435 4 Left 1104887428 12:132118905-132118927 CCCCTCCACGGGGCCTCCCGTGC 0: 2
1: 0
2: 1
3: 21
4: 193
Right 1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG 0: 1
1: 0
2: 1
3: 4
4: 105
1104887429_1104887435 3 Left 1104887429 12:132118906-132118928 CCCTCCACGGGGCCTCCCGTGCA 0: 2
1: 0
2: 0
3: 5
4: 107
Right 1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG 0: 1
1: 0
2: 1
3: 4
4: 105
1104887432_1104887435 -9 Left 1104887432 12:132118918-132118940 CCTCCCGTGCAGAACGCCTCCAG 0: 1
1: 0
2: 1
3: 2
4: 48
Right 1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG 0: 1
1: 0
2: 1
3: 4
4: 105
1104887430_1104887435 2 Left 1104887430 12:132118907-132118929 CCTCCACGGGGCCTCCCGTGCAG 0: 2
1: 0
2: 1
3: 10
4: 128
Right 1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG 0: 1
1: 0
2: 1
3: 4
4: 105
1104887431_1104887435 -1 Left 1104887431 12:132118910-132118932 CCACGGGGCCTCCCGTGCAGAAC 0: 2
1: 0
2: 1
3: 12
4: 92
Right 1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG 0: 1
1: 0
2: 1
3: 4
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104887435 Original CRISPR CGCCTCCAGCTTGCACACGC CGG Intronic
903351300 1:22718198-22718220 CCCCTCCAGCCTGCCCACTCAGG + Intronic
904002263 1:27345492-27345514 CTCCTCCAGCTGGCGCAGGCGGG - Exonic
909911253 1:81260623-81260645 CACCTCCAACTTGCTCACACTGG + Intergenic
916656055 1:166876204-166876226 CGCCTCCAGCTCGCTCACAAAGG + Exonic
919130322 1:193442484-193442506 TGCCTGCAGCTTTCACAGGCTGG - Intergenic
920844304 1:209580852-209580874 CTCCTCCTGTTTGCACACTCTGG - Intergenic
922526553 1:226308846-226308868 CGCCTCCGCCTGGCACAGGCTGG + Intronic
924474325 1:244369923-244369945 CGCCTCCATGTTGAACATGCTGG + Intronic
1063165284 10:3456193-3456215 TGTCTCCAGCTTTCACACACTGG + Intergenic
1065483616 10:26216762-26216784 CGCCCGCAGCTCGCACTCGCAGG + Exonic
1076858508 10:133128848-133128870 CGCCGCCTGCCTGCACTCGCCGG + Exonic
1077401760 11:2362003-2362025 GGTCTCCAGCTTGCACAGACAGG + Intergenic
1078144318 11:8712670-8712692 CGCCCCCAGCTATCGCACGCTGG - Exonic
1078708140 11:13764828-13764850 CCCACCCAGCTTGCTCACGCTGG + Intergenic
1078750207 11:14154402-14154424 GGCTTCCAGCTTGCACCCTCTGG + Intronic
1084089507 11:66870735-66870757 CGCCTCCAGCTGCCCCAGGCGGG + Intronic
1089822605 11:121241707-121241729 CATCTCCAGCTTGCACCCTCGGG - Intergenic
1102442397 12:112973702-112973724 AGTCTCCAGCTTGCAGACGGTGG - Intergenic
1104887435 12:132118932-132118954 CGCCTCCAGCTTGCACACGCCGG + Intronic
1105871183 13:24507177-24507199 CTCCTTCAGCTTGCAGGCGCAGG - Intronic
1111241665 13:85482548-85482570 AGCTTCCAGCTTGCACCCTCTGG + Intergenic
1112344097 13:98576528-98576550 CGGCTCCTGCACGCACACGCCGG + Intronic
1114514062 14:23286102-23286124 CGCCTCCAACTTGCTCGAGCAGG - Exonic
1118956765 14:70489745-70489767 AGCTTCCAGCTTGCACCCTCTGG + Intergenic
1123025783 14:105423090-105423112 CGCCTGCAGCTTGCTCATGTGGG + Intronic
1123705845 15:22950716-22950738 CACATACAGCTTGGACACGCTGG - Intronic
1125760550 15:42093237-42093259 CGCCTCCAGCTGGCATTCACAGG - Intronic
1126905134 15:53356746-53356768 GCTCTCCAGCTTGCAGACGCAGG + Intergenic
1129885601 15:79035137-79035159 CATCTCCAGCTGGCCCACGCTGG - Exonic
1133270738 16:4609785-4609807 GGCCTCCAGCTGGCCCACGGCGG - Exonic
1133421364 16:5649944-5649966 CGCCTCCCGGTGGAACACGCGGG + Intergenic
1139068164 16:63345321-63345343 CGCCTGCAGCTGGAACACACAGG + Intergenic
1142154129 16:88525557-88525579 TGCCTCCAGATTGGACACCCAGG + Intronic
1142570126 17:868246-868268 CTCCTCCAGCCTTCACACGTGGG + Intronic
1143016144 17:3892329-3892351 CGCCTCCAAACAGCACACGCAGG + Intronic
1147110307 17:38256907-38256929 GGCCTCCAGCTTGCCCTCGAAGG + Intergenic
1147350060 17:39835340-39835362 GGCCTCCAGCTTGGACCCCCTGG + Intronic
1147400830 17:40179023-40179045 CGCCTCCAGCTTCCACCCTTCGG + Intronic
1147990372 17:44328990-44329012 CCCCTCCAGCTTGAACCCCCAGG + Intergenic
1148419203 17:47531524-47531546 GGCCTCCAGCTTGCCCTCGAAGG - Exonic
1156729672 18:40176354-40176376 CCCCAGCAGCTTGCACAGGCAGG - Intergenic
1157522141 18:48352595-48352617 CTCCTCCAGCCTGCTCACCCTGG - Intronic
1157743549 18:50114930-50114952 TGCCTCCTGCTTTCACACCCAGG + Intronic
1158181354 18:54718110-54718132 CGCCTCCAGATTGCAGCCTCTGG - Intronic
1160720435 19:594759-594781 CCCCACCATCCTGCACACGCTGG - Intronic
1161006779 19:1941158-1941180 CGCCCCCCGCTGGCAGACGCTGG + Exonic
1161204978 19:3036217-3036239 CTCCTCCAGCTTCCACGCTCGGG - Intronic
1161367737 19:3890632-3890654 GGCCTCCAGCTTGCATTTGCAGG - Intronic
1161428540 19:4217568-4217590 CGCCTCCAGCTCCCGCAGGCGGG - Exonic
1161468823 19:4446404-4446426 CGCCTCGGACCTGCACACGCGGG + Exonic
1165129489 19:33622835-33622857 CGCCTCCAGCACTCACAGGCCGG - Intronic
1167211794 19:48138117-48138139 AGCCACCAGCTTACACACGTGGG + Intronic
929589609 2:43136328-43136350 GGCCTCCAGCAGGCAGACGCAGG - Intergenic
929701769 2:44168806-44168828 CGCCTCCAGCTGCCACCCACTGG - Intronic
931270772 2:60700412-60700434 GGCCTCCAGCTTGCAGACTGTGG - Intergenic
931496564 2:62813559-62813581 CGCCTGCAGCTTTCCCAGGCTGG - Intronic
932432792 2:71685705-71685727 CGCCTCCTGCCTCCCCACGCTGG - Intronic
938160463 2:128980630-128980652 CGCCTCCAGCAGCCACATGCAGG - Intergenic
944495958 2:200307151-200307173 CTCCTCCCGCTTGCCCGCGCCGG - Intronic
945564764 2:211383630-211383652 CGCCTCCACCTTACAGACACCGG - Exonic
947156037 2:227164123-227164145 CGCCTCCAACTTGCGGCCGCCGG - Intergenic
1171108967 20:22463116-22463138 TGCCTCCAGCTTGTGCATGCGGG - Intergenic
1172854084 20:37987917-37987939 CGCCCCCAGCTTGCTCACTAGGG - Intronic
1173454181 20:43190068-43190090 CGCCCGCGGCTGGCACACGCGGG + Intergenic
1177579844 21:23007540-23007562 GGCCTCGAGCTTGCAGAAGCTGG - Intergenic
1181694696 22:24587253-24587275 GGCCCCCAGCCTGCACACCCAGG - Intronic
1182743635 22:32587725-32587747 CGCCAGCATCTTGCACACGCTGG - Intronic
1183672549 22:39281594-39281616 CGCCTCCCTCTTGCACATCCAGG - Intergenic
1184882370 22:47316963-47316985 CGAGTCCATCTTCCACACGCGGG + Intergenic
1185254190 22:49823130-49823152 CGCCTCCAGGCTGCACCCGGAGG - Exonic
951013772 3:17706088-17706110 GGCCTCCAGCTTGCCCTCGAAGG + Intronic
953183241 3:40615738-40615760 CGCCTGCAGATTGCGCAGGCTGG - Intergenic
953405742 3:42658969-42658991 ACCCTCCAGCTTGCACAAGCTGG - Exonic
963065178 3:141258101-141258123 CGCCTCCCACATGCAAACGCAGG + Intronic
969559566 4:7938934-7938956 CGCCTCTCGCTTCCACCCGCCGG + Intronic
969619161 4:8270261-8270283 CGCCTGCAGCGCGCACACGTTGG - Exonic
971686657 4:29778384-29778406 TGCCTCCAGAATTCACACGCTGG + Intergenic
979169033 4:117576029-117576051 CGCCACCAGGGCGCACACGCTGG + Intergenic
985071438 4:186170189-186170211 CTCCTCCGGATTGCACAGGCCGG - Intronic
985906927 5:2846049-2846071 GGCCTCCAGCTTGCAGAGGCAGG - Intergenic
986062105 5:4201580-4201602 CCCCTGCAGCCTGCACACCCAGG + Intergenic
987221323 5:15793030-15793052 GGCATGCAGCTTGCACACGCAGG - Intronic
991108998 5:62876349-62876371 GGTCTCCAGCTTGCAGACGGTGG + Intergenic
992933839 5:81680199-81680221 GGCCTCCAGCTTGCAGATGAAGG + Intronic
994137242 5:96302146-96302168 CGCTTACAGCTTGCACCCTCTGG + Intergenic
1017030383 6:150215878-150215900 TGCCACCATCTTGCACAGGCTGG + Intronic
1017582351 6:155880061-155880083 CGCATTTATCTTGCACACGCTGG - Intergenic
1019308182 7:346337-346359 GGTCTCCAGCCTGCAGACGCAGG + Intergenic
1022734395 7:33062640-33062662 CGCCACCAGGGCGCACACGCTGG + Exonic
1022741749 7:33129063-33129085 CGCCACCAGGGCGCACACGCTGG + Intergenic
1024302661 7:47899588-47899610 CGCCTCCACCCTGCAGATGCTGG + Intronic
1026148448 7:67768496-67768518 CTCCTCCAGGTTGCACAGCCAGG + Intergenic
1028207226 7:88031889-88031911 CAGCTCCAGCTTGCACCCTCTGG - Intronic
1035253801 7:157613650-157613672 CGCCTCCGTCTCCCACACGCAGG + Intronic
1039438748 8:37579921-37579943 CTCCTCCACCTGCCACACGCAGG - Intergenic
1039819047 8:41120112-41120134 AGCCTCCAGCTTGTGCACACTGG + Intergenic
1043426828 8:80156245-80156267 GGCCTCCAGCATGCAGACTCAGG + Intronic
1047732600 8:127738778-127738800 CACCTCCAGCTTGTACCTGCAGG + Exonic
1048444388 8:134482240-134482262 CGCCTCCCACTTGCAGACGGAGG - Intronic
1049735791 8:144203606-144203628 CGCCTGCAGCTTCCACACAGAGG + Intronic
1050936611 9:11404746-11404768 CACCTCCAGCATTCACACGGGGG - Intergenic
1051214192 9:14778780-14778802 CGCCTATAGCTTGGACACTCTGG + Intronic
1059234722 9:112751413-112751435 CGCCTCCCGCTCCAACACGCAGG - Intronic
1060010812 9:120041463-120041485 CGCCTCCAGCAGGGACACACGGG - Intergenic
1062404624 9:136389543-136389565 GCCCTGCAGCTTGCACACCCCGG - Intronic
1203759832 EBV:6487-6509 CGCCACCAGATGGCACACGTGGG + Intergenic
1189850124 X:45169510-45169532 CTCCTCCAGCTGGCCCAGGCTGG + Intronic
1191122606 X:56921767-56921789 AGCATCCAGCTTGCACCCTCTGG - Intergenic
1193296039 X:79831583-79831605 AGCCTGCAGATGGCACACGCAGG - Intergenic
1197614478 X:128675980-128676002 TGCCTCCAGCATGCACAGGACGG - Intergenic
1199259360 X:145753098-145753120 TGCCTCCAGCTTGGACACGCTGG + Intergenic