ID: 1104888302

View in Genome Browser
Species Human (GRCh38)
Location 12:132125000-132125022
Sequence CAGGAGCCACGTGGTTCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104888302_1104888306 8 Left 1104888302 12:132125000-132125022 CCATTAGAACCACGTGGCTCCTG 0: 1
1: 0
2: 2
3: 10
4: 108
Right 1104888306 12:132125031-132125053 CCCGTGATACCAGAGATACCTGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104888302 Original CRISPR CAGGAGCCACGTGGTTCTAA TGG (reversed) Intronic
902450160 1:16491550-16491572 CAGTAGCCACGTAGTGCGAAAGG + Intergenic
904933340 1:34108122-34108144 CAGGAGCCATGTGTTTTTAATGG - Intronic
905571081 1:39006307-39006329 CAGGAGCCACTTAGTTGGAATGG - Intergenic
905605219 1:39292065-39292087 CAGGAGGGACGTGGTTGGAACGG + Intronic
915021723 1:152786147-152786169 CAGGACCCACGTGGGTATCAGGG + Intronic
916861412 1:168809678-168809700 CAGGAGCCACCTGTGTCCAATGG + Intergenic
918528546 1:185491173-185491195 CACAAGCCAAGTGGTTCTACAGG - Intergenic
918593297 1:186263658-186263680 CAGGAGCCACATGGTACTGTAGG - Intergenic
922346077 1:224697595-224697617 CACGAGCCACGTGCTTTTCATGG + Intronic
922710746 1:227829029-227829051 CAGGAGCCACATGGACCCAAAGG - Intronic
924593640 1:245426736-245426758 GAGAAGCCACGTGGTCCTGAAGG - Intronic
1064321749 10:14311417-14311439 CATGAGCCATCTGGTTCTATAGG + Intronic
1070043142 10:72802168-72802190 CAGGAGGCACATGGTTCTGGAGG + Intronic
1075872788 10:125782866-125782888 CAGGGGCCACGTGGTGCAGATGG - Intergenic
1076441124 10:130482001-130482023 CAGGAGTCATTTGGTTATAAGGG + Intergenic
1077051769 11:569743-569765 AAGGAGCCACTCGGTTCTATCGG - Intergenic
1078347995 11:10568473-10568495 CAGGAGCCTCGTGGTCCAGATGG + Exonic
1084713806 11:70860941-70860963 CAGGAGCCGCGTGCATCTCAGGG + Intronic
1090238626 11:125166539-125166561 CAGGAGCCACCTGGGTCTGCGGG + Intronic
1093846702 12:23980743-23980765 CATGAGCCATGTGGTTCTCTGGG - Intergenic
1095944541 12:47746522-47746544 CAGGAGCCCCGTGGGCCTCAGGG + Intronic
1097334628 12:58368586-58368608 CAGTAGCCACATGTATCTAATGG - Intergenic
1099182522 12:79484613-79484635 CACTAGCCACGTGGTGCTAATGG + Intergenic
1104888302 12:132125000-132125022 CAGGAGCCACGTGGTTCTAATGG - Intronic
1105369772 13:19792310-19792332 CAGGAGCCACTGGGTTCACAGGG - Intergenic
1111253390 13:85635446-85635468 CAGGAGTCACTAGGTTCTTAGGG - Intergenic
1111873777 13:93867519-93867541 CAGGACACACATGGTTCTGAGGG - Intronic
1114883408 14:26815294-26815316 CAGAAGCCATCTGGTTATAAGGG - Intergenic
1116913947 14:50502897-50502919 CAGGAGCAAGTTTGTTCTAAGGG - Intronic
1118817420 14:69323281-69323303 CAGGAGCCAGGAGCCTCTAAAGG - Intronic
1123501874 15:20893674-20893696 CAGGAGGCAGGTGGTACAAATGG + Intergenic
1123559127 15:21467373-21467395 CAGGAGGCAGGTGGTACAAATGG + Intergenic
1123595358 15:21904654-21904676 CAGGAGGCAGGTGGTACAAATGG + Intergenic
1128544637 15:68558785-68558807 AAGGAGCCAGGTGGATCTCAGGG + Intergenic
1129333114 15:74837902-74837924 CAGGAGGCAAGTTGTTCTGATGG - Intronic
1129766510 15:78172918-78172940 CTGGAGTCACGTGGTTCTAGGGG - Intronic
1130986192 15:88846138-88846160 CATGTGCCACATAGTTCTAAGGG + Intronic
1202967475 15_KI270727v1_random:194532-194554 CAGGAGGCAGGTGGTACAAATGG + Intergenic
1132541929 16:514191-514213 CAGGAACCTTGTGGTTCTCAGGG + Intronic
1135715228 16:24758956-24758978 CAGGAGCTACTTGGTAATAAAGG + Intronic
1136373820 16:29852994-29853016 CAGGAGCCACGTGTTGAAAATGG + Intergenic
1136999215 16:35214838-35214860 CAGCAGCAAGGTGGTTTTAATGG - Intergenic
1143329592 17:6123559-6123581 CAGTAGCCACTTGGTTCTTAGGG + Exonic
1149526797 17:57362625-57362647 GAGGAGCCATGTGGTTCTAGGGG + Intronic
1152567643 17:81107287-81107309 AGGGAGCCCCGTGGTTCTCACGG - Intronic
1153953567 18:10076876-10076898 GAGGCGCCACGTGGTTCAGAGGG - Intergenic
1160549361 18:79683524-79683546 CAAGAGCCACGGGGTTCCATTGG - Intronic
1161516236 19:4698157-4698179 CCAGAGCCACCTGGCTCTAAGGG - Intronic
1167835116 19:52061862-52061884 CAAGAGCCACTTGTCTCTAAGGG + Intronic
1168722481 19:58561822-58561844 CAGGAACCACGTGGTTACAGAGG + Intergenic
926784574 2:16507637-16507659 CAGCAGCCGTGTGGTTCTCAGGG + Intergenic
928059854 2:28100840-28100862 CAGGAGCGAGTAGGTTCTAAGGG + Intronic
932668784 2:73719152-73719174 CAGGAGCCAGGTTATACTAAAGG + Intergenic
935828818 2:106978089-106978111 CAGGAGCCAGCTGGTGATAATGG + Intergenic
938697676 2:133849245-133849267 CAGGAGCCACTTGGCTAAAAGGG - Intergenic
945036300 2:205706811-205706833 CAAGAGCCACGTGTGTATAAAGG - Intronic
945452317 2:210008021-210008043 CATGAGCCACTTGGATGTAAAGG + Intronic
945987559 2:216367538-216367560 CAGGAGCCAAGAGGCTTTAATGG - Intronic
946032499 2:216716352-216716374 CAGGAACCACTTGGTTCCAGAGG - Intergenic
948341769 2:237258565-237258587 CAGGAGCCCCATAGTTCTCAAGG + Intergenic
948616028 2:239199630-239199652 CAGGAGCCCCGTGGTTGGATCGG + Intronic
948775723 2:240287929-240287951 CAGGTGCCACATTGTTCAAATGG - Intergenic
948791914 2:240383578-240383600 CATGAGCCACGAGGTTCAGAGGG + Intergenic
1169413289 20:5393082-5393104 TAAGAGCCAGGTGGTTCTCATGG + Intergenic
1169755771 20:9041411-9041433 CAGGAGCCACATGGTGATAATGG - Intergenic
1177607318 21:23398368-23398390 CTTGAGCAACGTGCTTCTAAGGG - Intergenic
1179052685 21:37902040-37902062 CTGGAGTCATGTGGTTCTATGGG - Intronic
1180073870 21:45451910-45451932 CAGGAACCACTTGGCTCTGATGG - Intronic
1183206749 22:36424737-36424759 GAGGAGCCACGTGGTGTTCAGGG - Intergenic
1184682668 22:46080399-46080421 CAGGAGCCATGTGGTGCTGGGGG - Intronic
953852430 3:46475613-46475635 AAGGAGCCACATGGTTCCCATGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
964662252 3:159133174-159133196 CAGGACACATGTGGTTCTCAGGG + Intronic
968884679 4:3321447-3321469 CAGGAGCCATGTGGTCTTCAAGG + Intronic
971699795 4:29956333-29956355 TAAGAGCCAAGTGGTTTTAATGG - Intergenic
974535476 4:63168370-63168392 CAGGAGCCACGAGGCTCTGGAGG + Intergenic
976402581 4:84623950-84623972 CAGGAGCCAGGTGTTTCAAGAGG + Intronic
978916780 4:114135326-114135348 CAGGACCCAGGTGGTTTTAATGG + Intergenic
979755221 4:124332023-124332045 CAGGAGCCATGTGGTTCTTATGG - Intergenic
984364697 4:178783686-178783708 CAGGATCCTCCTGGTTCTCAAGG + Intergenic
992214897 5:74516344-74516366 CAAGAGCCAGGTCATTCTAAAGG - Intergenic
996005777 5:118419551-118419573 CAGGAGCCACATGGCTCAAGGGG + Intergenic
998561211 5:143173380-143173402 CAGGAGCCACGAGGGCCTAGAGG + Intronic
1000203605 5:159036030-159036052 CAGGAGAGACTTGGTTCTTAGGG + Intronic
1002338496 5:178497227-178497249 GAGGAGCCACGCGGTCCTAATGG + Intronic
1005742249 6:28802985-28803007 CAGGAGATACTTGGTACTAATGG + Intergenic
1005743823 6:28817421-28817443 CAGGAGATACTTGGTACTAATGG + Intergenic
1013754882 6:113449618-113449640 CAATAGCCACGTGGGCCTAATGG + Intergenic
1014583113 6:123162333-123162355 CTGGACCCACGTGGGTCTTAGGG + Intergenic
1015709281 6:136121668-136121690 CAAGTGTCACGAGGTTCTAATGG + Intronic
1018143509 6:160862809-160862831 CAGGAGCCACATGATTCTCTAGG + Intergenic
1021263202 7:18484606-18484628 TAGGAGCTAAATGGTTCTAAGGG - Intronic
1022385375 7:29893831-29893853 CAGGGGCCAGGTGGGTGTAAGGG - Intronic
1023172022 7:37399092-37399114 CAGGAGCCACCTGGATCCAGAGG + Intronic
1024172335 7:46802878-46802900 CAGGAGCCATCAGGTTCTCATGG - Intergenic
1030732757 7:113009159-113009181 CAGGAGCCACGTGGGGCAAGGGG - Intergenic
1033977328 7:147117399-147117421 CAGGAGCGACGTGGAGCCAAGGG - Intronic
1034844779 7:154434374-154434396 CAGCAGCCACATGCTTCTAAAGG - Intronic
1040960664 8:53028880-53028902 CATGAGCCACATGATTCTTAGGG + Intergenic
1042395398 8:68286029-68286051 CAGGAGCCTCTTTGTTCCAAGGG - Intergenic
1042784168 8:72528625-72528647 CAGCAGCCACGTTTTTCAAATGG + Intergenic
1044923076 8:97186126-97186148 CAGCAGCAACGTGGTTCTAATGG + Intergenic
1045381784 8:101634660-101634682 CAGCAGCCCTGTGGTTCTCATGG + Intronic
1046581388 8:116097077-116097099 CAAGAGCCATGTGTTTCAAATGG + Intergenic
1053281473 9:36822765-36822787 CAGGAGCCACGTGGACATTAAGG - Intergenic
1056064402 9:82918382-82918404 CAGTGGCCACGTGTTTCTAGTGG - Intergenic
1056233278 9:84568497-84568519 CAGCAGGCACTTGCTTCTAAGGG + Intergenic
1057396243 9:94682971-94682993 CAGTAGCCACCAGGTTCTCATGG - Intergenic
1058183332 9:101824314-101824336 CTGGAGCCACCTGGTGCTATTGG - Intergenic
1060780617 9:126409609-126409631 CGGGAGCCACGTGGTGGCAAAGG - Intronic
1060883621 9:127135587-127135609 CAGGAGCCACCTACTTCTGAGGG + Intronic
1062686585 9:137816867-137816889 CGCGAGGCACGTGGTTCTGAGGG + Intronic
1185980320 X:4771970-4771992 CAGGTGCCACATGGTTCTGCAGG + Intergenic
1187654700 X:21458269-21458291 CAATAACCACGTGTTTCTAATGG + Intronic
1187719631 X:22137603-22137625 CCGGAGCCTGGTGGTTCTCAAGG + Intronic
1189338103 X:40183108-40183130 CTGGAGCCACATGTTTCTGAAGG - Intergenic
1193093981 X:77527370-77527392 CAGGAGCCACGTGGAGCAAAAGG + Intronic
1193438672 X:81512325-81512347 GAGGGGCCACGTGGAGCTAAAGG + Intergenic
1193854602 X:86584041-86584063 CCGGGCCCACGTGATTCTAATGG - Intronic
1194604806 X:95965325-95965347 CAGAAGTGAGGTGGTTCTAAAGG - Intergenic
1199451220 X:147981102-147981124 CACTGGCCACGTGGTTATAAGGG + Intergenic