ID: 1104889441

View in Genome Browser
Species Human (GRCh38)
Location 12:132133171-132133193
Sequence GCCCCCGTCAGGCGGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 210}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104889441_1104889451 -4 Left 1104889441 12:132133171-132133193 CCTCCCCCCCGCCTGACGGGGGC 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1104889451 12:132133190-132133212 GGGCTCCTCCTGCGGAGACCGGG 0: 1
1: 0
2: 0
3: 17
4: 202
1104889441_1104889454 13 Left 1104889441 12:132133171-132133193 CCTCCCCCCCGCCTGACGGGGGC 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1104889454 12:132133207-132133229 ACCGGGCCCAGCTGAGCCTGTGG 0: 1
1: 0
2: 6
3: 31
4: 324
1104889441_1104889450 -5 Left 1104889441 12:132133171-132133193 CCTCCCCCCCGCCTGACGGGGGC 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1104889450 12:132133189-132133211 GGGGCTCCTCCTGCGGAGACCGG 0: 1
1: 0
2: 0
3: 15
4: 171
1104889441_1104889456 14 Left 1104889441 12:132133171-132133193 CCTCCCCCCCGCCTGACGGGGGC 0: 1
1: 0
2: 0
3: 12
4: 210
Right 1104889456 12:132133208-132133230 CCGGGCCCAGCTGAGCCTGTGGG 0: 1
1: 0
2: 0
3: 41
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104889441 Original CRISPR GCCCCCGTCAGGCGGGGGGG AGG (reversed) Intergenic
900094605 1:935177-935199 CCCCCCGGCAGGCGGGGGCTTGG - Intronic
900110585 1:1003888-1003910 GCACCCGTTAGATGGGGGGGAGG - Intergenic
900427776 1:2588269-2588291 GCCCTGGTGAGGCGGGTGGGTGG + Intronic
900639607 1:3682379-3682401 GCCCCCATCAGGGGAGGTGGCGG - Exonic
901734765 1:11305660-11305682 GCCCCCGTCCGGGAGGTGGGGGG - Intergenic
901739902 1:11335082-11335104 GGCCCGGTGAGGCGGGGAGGGGG - Intergenic
902323501 1:15684088-15684110 GTCCCCGGCAGGCGGGGTCGAGG + Intergenic
902350429 1:15849537-15849559 GTCCTCGGCAGGCCGGGGGGAGG + Intronic
902399977 1:16152379-16152401 GCCCCGGTCAGTAGTGGGGGTGG - Intronic
903181803 1:21608599-21608621 GGACCTGTCAGGTGGGGGGGTGG - Intronic
903186894 1:21634049-21634071 GCCCCCTCCCGGGGGGGGGGGGG + Intronic
904044132 1:27600179-27600201 GCCCCCCCCAGGGAGGGGGGCGG - Intronic
904181324 1:28668816-28668838 GTCTCCGTCGGGCGGGCGGGCGG - Exonic
905171915 1:36114692-36114714 GCCCGCCTCAGGCAGGAGGGAGG - Intronic
907038362 1:51236451-51236473 GCCGCCGCCCCGCGGGGGGGCGG + Exonic
913222140 1:116667870-116667892 GCCCCCGCCAGGCCCGGGGCCGG - Intergenic
915074191 1:153295386-153295408 GCCCCCTTCTGGTGGAGGGGTGG - Intergenic
915172087 1:153985439-153985461 GCCCCCAGCAGGCTTGGGGGAGG - Intronic
916115064 1:161479253-161479275 CCCACCGTCCGGGGGGGGGGGGG - Intergenic
916168409 1:161983029-161983051 GCCCCTATCAGGAGGGGAGGAGG + Intergenic
916773421 1:167936076-167936098 GCCCCCGGCAGGAGAGAGGGAGG + Intronic
917981493 1:180272261-180272283 GCCCCAGTCAGCAGGAGGGGAGG - Intronic
922539496 1:226408157-226408179 GCCCCCTGCCGGCCGGGGGGCGG + Intergenic
922757004 1:228102282-228102304 GCTGCGGTCAGGCGGGGCGGGGG + Intronic
1066086833 10:31979329-31979351 GCCCCCGCCTGGCAGGAGGGAGG - Intergenic
1070238463 10:74655001-74655023 GCCCCAGTCAGGAGGGGTCGGGG - Intronic
1070257940 10:74826749-74826771 GCCCCCGGCAGGCGCGGTGGCGG + Exonic
1071291629 10:84193477-84193499 GCCCCTGGCAGGGGGAGGGGGGG + Intergenic
1075264648 10:120990141-120990163 GCCCCAGCCAGGAGGGGAGGGGG - Intergenic
1075768937 10:124917217-124917239 GCGCCCGTCGGACGGGGAGGAGG + Intergenic
1076298294 10:129404330-129404352 GCCACCGACAGGCGTCGGGGGGG + Intergenic
1076998597 11:311152-311174 GGCCCCGCCCGGCGGGGAGGGGG + Intronic
1077000146 11:318607-318629 GGCCCCGCCCGGCGGGGAGGGGG - Intergenic
1077675030 11:4187710-4187732 GCCCCCGTGAGGCCGCGGGTGGG - Intergenic
1078442077 11:11376632-11376654 GCCCCCGGCAGTAGGGGTGGAGG - Intronic
1081871094 11:46382796-46382818 TCCCCTCACAGGCGGGGGGGGGG - Intronic
1083685173 11:64371235-64371257 GCCGGGGTCAGGCGGGGGTGGGG + Intronic
1083876061 11:65525046-65525068 GCCTGCGTCAGACGGGGGCGGGG - Intergenic
1084628117 11:70324541-70324563 GCCACTGTCAGGAGGAGGGGCGG + Intronic
1086337135 11:85811185-85811207 GCCCCCGGCGGGCGGTGCGGTGG + Intergenic
1088250315 11:107856717-107856739 GACTCCGTCAGGAGGGAGGGAGG + Intronic
1089759246 11:120710985-120711007 GCCCCTGTGAGGTGGGGAGGGGG + Intronic
1090699220 11:129279356-129279378 CGCCCCGTCAGGCTCGGGGGCGG + Intergenic
1091120057 11:133049860-133049882 GACCCCCTCAGGAGGGTGGGAGG + Intronic
1092171308 12:6375493-6375515 GCACCTGTCAGGTGAGGGGGAGG - Intronic
1092241962 12:6840875-6840897 GGCCCCGACCGGCGGGGGGTTGG - Exonic
1092538794 12:9407056-9407078 GTCCCCGCCTCGCGGGGGGGGGG - Intergenic
1095160074 12:38905600-38905622 GCTCCCGTCAGGCGGGGATGGGG + Exonic
1096691807 12:53325925-53325947 GCCCCAGTCGGGCGGTGGTGCGG - Intergenic
1096848213 12:54419307-54419329 CCCCTCGGCAGGCGGGGGGAGGG - Exonic
1101796789 12:107982393-107982415 GCCCCCATCAGCAGGGGGGTGGG + Intergenic
1102229125 12:111250243-111250265 GCCCACTTCAGGTGTGGGGGTGG + Intronic
1102680292 12:114686313-114686335 GCACCCTTCAGGTGGGGAGGAGG - Intergenic
1104808403 12:131604308-131604330 GCTCCAGGCAGGCGGGGGTGTGG - Intergenic
1104865287 12:131949991-131950013 GGCCGCGTCAGGAGGGCGGGAGG - Intronic
1104889441 12:132133171-132133193 GCCCCCGTCAGGCGGGGGGGAGG - Intergenic
1104983394 12:132583635-132583657 GCCGCCGTCACCAGGGGGGGCGG - Exonic
1106730604 13:32538060-32538082 GACCCCGTCTTGGGGGGGGGGGG + Intronic
1112567613 13:100564813-100564835 GCCCCGGGCAGGGGGCGGGGGGG + Intronic
1113431797 13:110256729-110256751 GCCCCAGACCGGCGGCGGGGGGG + Intronic
1113858967 13:113468669-113468691 GCCCTGGACAGGCGGGGCGGAGG + Intronic
1113928089 13:113952309-113952331 GCCCTGGGCAGGCGGAGGGGTGG - Intergenic
1117029288 14:51652074-51652096 GCCCCCTGCCGGCGGGGCGGCGG + Intronic
1119678512 14:76574459-76574481 GGCTCCGTGAGGCGGGGGGTGGG - Intergenic
1121419757 14:93804829-93804851 GCCCCCGTGAGGCTGGAGTGGGG - Intergenic
1122271176 14:100569003-100569025 GCCCTCGCCCGGCGGGGCGGTGG - Intronic
1122663965 14:103316250-103316272 GCCCCAGTCAGGCTGGCGGCGGG - Intergenic
1202904376 14_GL000194v1_random:59939-59961 GCGCCAGGCAGGCGGAGGGGAGG - Intergenic
1202934537 14_KI270725v1_random:74171-74193 GCGCCTGTCAGGGGGGTGGGAGG - Intergenic
1123796936 15:23781819-23781841 CCCCCTGGCAGGCGGGGAGGGGG + Intergenic
1125464115 15:39934126-39934148 GCCCCCGGCAGCCTGCGGGGCGG - Intronic
1127071247 15:55289907-55289929 GCCCCCGCCCGGCTGGCGGGGGG + Intronic
1129739887 15:77985091-77985113 GCCCCCGCCAGGTGGTGGGCAGG + Intronic
1132375782 15:101327347-101327369 CTACCCGTCAGGCGGGGGCGGGG + Intronic
1133130877 16:3675555-3675577 GCCCCCGTGAGACTGGGGGGAGG - Intronic
1133224263 16:4333121-4333143 GCCCCCGTGAGCCGGGGAGGGGG - Intronic
1133270657 16:4609580-4609602 GACCCCGTGGGGCGGGGGAGAGG - Exonic
1133288238 16:4701235-4701257 GCCCCTGTGTGGCGGGTGGGGGG - Intronic
1136254544 16:29029401-29029423 GCTCCCGGCAGCCGGGGGAGGGG + Intergenic
1136429367 16:30187832-30187854 GGCCTCGTCGGGCGGGGTGGGGG + Intronic
1137382713 16:48013678-48013700 GCCCCAGGGAGGTGGGGGGGGGG + Intergenic
1141110792 16:81269214-81269236 GCTCCCTTCAGACGTGGGGGTGG - Intronic
1141430493 16:83968424-83968446 GCGCCCGGCCGGCGGGGGTGGGG + Intergenic
1141542301 16:84735115-84735137 ACCCCCCTGAGGCGGGGCGGGGG - Intronic
1142549936 17:732400-732422 GTCCCCGGCGGGCGGGTGGGCGG - Exonic
1143016357 17:3893017-3893039 GCCCCAGCGAGGCGGTGGGGCGG - Exonic
1143086379 17:4419070-4419092 GACTCCGTCTTGCGGGGGGGAGG + Intergenic
1143190322 17:5035512-5035534 GCCCCCCTGAGGCAGGCGGGAGG - Intronic
1143560012 17:7688178-7688200 GCCCTCTGCAGGCGGCGGGGGGG + Exonic
1143772615 17:9178324-9178346 GCCCCCATCAGGTGGGAGGAGGG - Intronic
1144339972 17:14302685-14302707 GCCTCCGCCTGGCGGGCGGGCGG + Intronic
1147448933 17:40491810-40491832 GCCCCAGGCAGGCGGGTGAGTGG + Intronic
1148867055 17:50634316-50634338 GTACCCGTGAGGCGGGGGTGGGG - Intergenic
1149614646 17:57988009-57988031 GCCCCGGGCTGGCGGGCGGGCGG - Intronic
1151767844 17:76141218-76141240 AGCGCCGTCGGGCGGGGGGGCGG - Exonic
1152699385 17:81811578-81811600 GCCCCAGGCAGGTGGGTGGGTGG + Intronic
1153636484 18:7117608-7117630 GTCCCCCGCAGGCGGGCGGGCGG - Intronic
1155955319 18:31951913-31951935 GACCCCGTCTGGGGGAGGGGGGG + Intronic
1160788321 19:912088-912110 GCCCCGGGGAGGTGGGGGGGGGG + Intronic
1160833076 19:1112324-1112346 GGCCCGGCCAGGCGGGGGCGGGG + Intronic
1160905029 19:1447904-1447926 GCCCCCATCAGGCAGGGGTTTGG - Intronic
1160919488 19:1513103-1513125 GCCCGGGTCAGGAGGGGCGGCGG + Exonic
1161217769 19:3103005-3103027 GCCCCCACCAGGCTGCGGGGAGG - Intronic
1161739200 19:6010107-6010129 GGCCCGGTCAGGCCCGGGGGCGG - Intronic
1162403842 19:10461818-10461840 GCCCGGGTCAGTCTGGGGGGCGG + Intronic
1163334354 19:16661190-16661212 GCACCCGGCAGGCGGGCAGGCGG + Exonic
1163458979 19:17425028-17425050 GCCCCAGGCTGGCGGGGAGGTGG - Exonic
1163607271 19:18281988-18282010 GCCCCGGCCGGGCGGGGGCGGGG + Intergenic
1165213801 19:34254920-34254942 GCGCCCGTCAGGCGGGGAAAGGG + Intronic
1165827665 19:38714407-38714429 GTGCCCGTCAGGAGGGAGGGTGG + Intronic
1166219994 19:41357987-41358009 GCTCCTGTCAGGCGTGCGGGAGG - Exonic
1166302632 19:41921147-41921169 GCCACCGTGAGGCGAGGCGGAGG + Intronic
1167292242 19:48630657-48630679 GCCCCCGCAAGGGAGGGGGGAGG + Exonic
1168309393 19:55452894-55452916 GTCCCCAGCAGGTGGGGGGGGGG - Intergenic
927168733 2:20350842-20350864 GCGCCCGGTGGGCGGGGGGGAGG - Intronic
927713563 2:25340137-25340159 GCCTGCGGCAGGCGGGAGGGTGG - Intronic
927888215 2:26731260-26731282 GACCCCGGCAGGGGAGGGGGTGG - Exonic
930730702 2:54725016-54725038 GGCCCCGGCGCGCGGGGGGGCGG + Exonic
931348791 2:61470740-61470762 GATCCCGACCGGCGGGGGGGAGG + Exonic
932343119 2:70979005-70979027 GCCCCCGCCTGGCTGGTGGGCGG - Intronic
932478679 2:72025021-72025043 GCCCACGGCAGGGCGGGGGGTGG - Intergenic
932599313 2:73112923-73112945 GGCCCGGTGAGGCGGGGAGGCGG - Exonic
933744549 2:85561280-85561302 CTCCCGGTGAGGCGGGGGGGGGG - Intronic
937905536 2:127051092-127051114 GCCCCGGACAGGCAGGCGGGCGG + Intronic
940817221 2:158310512-158310534 GGCCCCGTCTGGGGGGTGGGGGG - Intronic
941707116 2:168670968-168670990 GCTTCCGTCTGGGGGGGGGGGGG - Intronic
941773237 2:169364524-169364546 GCCGCCGGCTGGCGGGAGGGAGG + Intergenic
941814423 2:169785667-169785689 GCCCCCGTCCGGGAGGGAGGTGG - Intergenic
943669791 2:190648856-190648878 GCCGCCGCCGGGCGGGGGCGGGG - Intronic
946622179 2:221572518-221572540 CCCTCCGGCAGGCGGGGGCGGGG - Intronic
947592930 2:231395582-231395604 GTCCCCGCCAGGCGGCGGCGGGG + Exonic
948706401 2:239795924-239795946 GCCCCCCTCATCCGGGAGGGAGG + Intronic
949009876 2:241672333-241672355 GCCCTCGGCAGGCGAGCGGGCGG - Exonic
1169367278 20:5001553-5001575 GCCCCAGACCGGCGCGGGGGCGG - Intronic
1171810132 20:29740890-29740912 GCGCCCGGCAGGCGGGGGGCGGG + Intergenic
1175847031 20:62064848-62064870 GCCCCCGGCGGCCGGGGCGGGGG + Exonic
1176010136 20:62889031-62889053 GTCCCCGTCAGGCGGCGTCGTGG + Intronic
1176016767 20:62937986-62938008 GCCCCCGCGAGGGGGCGGGGCGG - Intergenic
1176207166 20:63895366-63895388 GGCCCGGGCAGGCGGGCGGGCGG + Intronic
1179787294 21:43737217-43737239 ACGCCCTTCAGGCTGGGGGGTGG + Intronic
1180102383 21:45594909-45594931 GCCCCAGGCAGGCAGGGGAGTGG - Intergenic
1180102428 21:45595039-45595061 GCCCCAGGCAGGCAGGGGAGTGG - Intergenic
1181494912 22:23282317-23282339 GCCCTCGGCAGGCGGGGTGTGGG + Intronic
1182430235 22:30294908-30294930 GCCCCGGGCAGGCAGGGGGGTGG - Intronic
1182435474 22:30326968-30326990 GCCGCCGCAAGGCCGGGGGGCGG + Intronic
1183601698 22:38843887-38843909 GCCCCCGGCAGGCGCGGCGGCGG + Exonic
1183653410 22:39171738-39171760 GCCCCCATCCGGCCCGGGGGTGG - Intergenic
1185099105 22:48828168-48828190 GTCCCTGGCAGGCGGGGTGGCGG + Intronic
1185259573 22:49854008-49854030 GCTCGCGGCAGGCGGCGGGGCGG - Intronic
1185388387 22:50546878-50546900 GCCCCTGGCAGGCGGGCGCGGGG + Intergenic
952866791 3:37860633-37860655 AGCCCCGTAAGCCGGGGGGGCGG - Intergenic
953027361 3:39152952-39152974 GCCCCCGGCCGGCGGGGGTCAGG - Intronic
955089235 3:55732939-55732961 GCCCCCGTCATTGGGGGTGGGGG - Intronic
955161274 3:56467773-56467795 GCCCCCGCCCGGGGGTGGGGTGG - Intronic
962788023 3:138785262-138785284 GCCCCCTCCAGGAGGTGGGGGGG + Intronic
963904556 3:150762991-150763013 GCGCCCGGCAGGCGGAGGGCTGG + Exonic
966015277 3:175132272-175132294 GCCCCCGTCTGGGAGGGAGGTGG - Intronic
966887174 3:184383158-184383180 GCGACGGTGAGGCGGGGGGGGGG + Exonic
967849544 3:194071408-194071430 GCCCCCGCCGGGCGTGGGGAAGG - Intergenic
967858209 3:194134142-194134164 GACCCGGGCAGGCGGGAGGGAGG + Intergenic
968398583 4:267292-267314 GACTCCGTCTGGGGGGGGGGGGG + Intergenic
968434283 4:576675-576697 GCCGCTGGCAGGCGGGTGGGCGG - Intergenic
968515014 4:1012111-1012133 GCCCACGTGGGGCGCGGGGGCGG - Intronic
968872969 4:3250815-3250837 GCCCCCCTCAGGCGAGGAGCCGG + Intronic
969471698 4:7392886-7392908 GCCCCTCCCAGTCGGGGGGGGGG + Intronic
973279315 4:48342093-48342115 GCGCCTGTCAGGCTGGGAGGAGG + Exonic
975661152 4:76689838-76689860 GCCCCCATCAGCCGGGGTGCTGG - Intronic
985749805 5:1667545-1667567 GCCCCCCCCAGGCTCGGGGGGGG - Intergenic
988369291 5:30346027-30346049 GCCCACGGGGGGCGGGGGGGGGG - Intergenic
991371784 5:65926338-65926360 GCACCCGGCCGGCGGGGGCGAGG - Intergenic
992013768 5:72556410-72556432 GGCCCCGTCAGCCGGGGAGAAGG - Intergenic
992877375 5:81070148-81070170 GCCACCTTCAGGCGAGGGGATGG + Intronic
997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG + Intergenic
998467377 5:142356840-142356862 CCTCCCGTCGGGCGGGGTGGGGG + Intergenic
1000815715 5:165919411-165919433 GCCCCCGTCTGGGAGGTGGGGGG + Intergenic
1002063904 5:176642856-176642878 GCCCACCTGGGGCGGGGGGGGGG - Intronic
1002093471 5:176817794-176817816 GCGCCCGTCGGGCGGGGCTGCGG + Intronic
1003937494 6:10990668-10990690 TCCCCTGTGTGGCGGGGGGGGGG - Intronic
1004178209 6:13359120-13359142 GCCCCAGTCAGTCTGGGTGGGGG + Exonic
1006187585 6:32189870-32189892 GCCCCCTCCAGGCGGGGGCCGGG - Exonic
1006313510 6:33277542-33277564 GCCCCGGTGAGGCGGGGGCTGGG - Exonic
1013368551 6:109452198-109452220 GCCACAGTCAGGCAGGGGGAGGG + Intronic
1013538729 6:111087446-111087468 GCCCCCAGCCGGCGGGGCGGGGG + Intergenic
1016199946 6:141394869-141394891 GCCACCGTCAAGCGTGGGGGTGG + Intergenic
1017206480 6:151808401-151808423 GCGCCCGGCAGGAGGGAGGGAGG + Intronic
1017843872 6:158240530-158240552 GCCCCCGTCCGGGAGGGAGGTGG - Intronic
1019601948 7:1889239-1889261 GCCCCCGTCGGGTGGTGGGAGGG - Intronic
1020125349 7:5530188-5530210 GCCCCCGCCAGGCCCGGTGGGGG - Intronic
1021558436 7:21945445-21945467 GCCCTCGTGAGACGGGGGAGGGG - Intronic
1024578256 7:50782247-50782269 GCCCGCGGCAGGCGGGCAGGGGG + Intronic
1025636260 7:63322252-63322274 GGGCCTGTCAGGCGGGTGGGGGG + Intergenic
1025646436 7:63425924-63425946 GGGCCTGTCAGGCGGGTGGGGGG - Intergenic
1025976877 7:66377094-66377116 GCCCCCGGCAGGCGGGAGCCGGG + Intronic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028430825 7:90744825-90744847 GCCCCCGTCCGGGAGGGAGGTGG - Intronic
1029640549 7:101816784-101816806 GCTCCGGCCAGGCGGGCGGGTGG + Intronic
1030033274 7:105388377-105388399 GCCACCGGCCGGCGGGCGGGAGG - Intronic
1032452535 7:132045584-132045606 GTCTCCGTCAGGCTGAGGGGAGG + Intergenic
1033390685 7:140924732-140924754 GCCGCTGTCGGGCGGGGAGGGGG + Exonic
1037663176 8:20944299-20944321 GCCTCCCTCAGGCTAGGGGGAGG - Intergenic
1049205481 8:141361636-141361658 GCCCCCGCCAGCCTGGAGGGAGG + Intronic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1049529674 8:143148096-143148118 GCCACTGTCAGGCGAGGGGCCGG + Intergenic
1049603793 8:143519957-143519979 GCCCTAGGCAGGCTGGGGGGTGG - Intronic
1049798374 8:144506651-144506673 GCTCAGGTCAGGCGGGGGCGGGG + Exonic
1050356977 9:4792853-4792875 GCCCCGGTCGGGCGGGGAGGCGG + Exonic
1052807297 9:33024850-33024872 GCGCCCGTAAGAGGGGGGGGGGG + Intronic
1056078228 9:83062861-83062883 GCCCCCGCCAGGCGGGATGGAGG - Exonic
1057230362 9:93317925-93317947 GCCCACAGCAGGCGGTGGGGGGG - Exonic
1060283302 9:122228110-122228132 GCGCGTGTCAGGCGGGCGGGCGG - Intronic
1060980026 9:127786379-127786401 GGCTCCGTCAGGCCGGGGCGGGG - Intronic
1061382384 9:130266147-130266169 GCGCCCGGCGGGCGGGGGTGCGG - Intergenic
1061808591 9:133149580-133149602 GCCCCCGCCTGGCTGGGGCGAGG - Intergenic
1062469588 9:136696745-136696767 GGCTCCGCCAGGCTGGGGGGTGG - Intergenic
1062530256 9:136996554-136996576 GCCGCGGTCAGGCGCGGGTGGGG + Exonic
1062628760 9:137454364-137454386 GACCCCGTGCGGCGGGGGTGGGG - Intronic
1203746930 Un_GL000218v1:45134-45156 GCGCCAGGCAGGCGGAGGGGAGG - Intergenic
1192177054 X:68892762-68892784 GCCCCGGGCAGGCGGGCAGGCGG + Intergenic
1195334084 X:103832270-103832292 GCGCCCGCCAGGGGAGGGGGCGG + Intergenic
1196031567 X:111098917-111098939 GCCCCCGGCAGGTGGGGGTGGGG - Intronic
1198800081 X:140439508-140439530 GCCCCCGCCAGGCGCGTCGGTGG - Intergenic
1200059061 X:153476021-153476043 GCCCCCCTCAGGCTGTGGGGTGG - Intronic
1201160255 Y:11160148-11160170 GCGCCAGGCAGGCGGAGGGGAGG - Intergenic