ID: 1104891459

View in Genome Browser
Species Human (GRCh38)
Location 12:132142176-132142198
Sequence TCTCGAAAGCAGGGCCTGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 123}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104891453_1104891459 2 Left 1104891453 12:132142151-132142173 CCAGGGCACGGATGTGGCAGACC 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1104891459 12:132142176-132142198 TCTCGAAAGCAGGGCCTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 123
1104891447_1104891459 26 Left 1104891447 12:132142127-132142149 CCAGCTCCTTGGTGGGCAGCACA 0: 1
1: 0
2: 0
3: 25
4: 204
Right 1104891459 12:132142176-132142198 TCTCGAAAGCAGGGCCTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 123
1104891448_1104891459 20 Left 1104891448 12:132142133-132142155 CCTTGGTGGGCAGCACAACCAGG 0: 1
1: 0
2: 1
3: 21
4: 163
Right 1104891459 12:132142176-132142198 TCTCGAAAGCAGGGCCTGAGGGG 0: 1
1: 0
2: 1
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104891459 Original CRISPR TCTCGAAAGCAGGGCCTGAG GGG Exonic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
904559038 1:31384577-31384599 TCCTGTAAGCAGGGCCTGGGTGG - Intergenic
905225762 1:36478129-36478151 CCTCTACAGCAGGGCTTGAGTGG + Intronic
907482546 1:54754848-54754870 CCTCGAGACCAGGTCCTGAGGGG - Intergenic
910669185 1:89756288-89756310 TCTCTAAAGGAGGGCCTTAGTGG - Intronic
911182906 1:94876929-94876951 CTTCCCAAGCAGGGCCTGAGTGG - Intronic
911487464 1:98519833-98519855 TGTCGAAGGCAGGGCCTGCTGGG - Intergenic
912511732 1:110194546-110194568 GGTGGAAAGCAGGGCCTGTGAGG - Intronic
916156510 1:161854975-161854997 ACTGGAATGCAGGGGCTGAGGGG + Intronic
920569649 1:207007107-207007129 TCTGGAGATCAGGGCCAGAGAGG + Intronic
1063830106 10:9942746-9942768 TCCCCAAAGCAGACCCTGAGAGG + Intergenic
1065320925 10:24509395-24509417 TCTAGAAAGCGGGGCCTTACAGG - Intronic
1067660900 10:48235610-48235632 TCTTGGAGGCAGGGCTTGAGTGG - Intronic
1069776535 10:70930385-70930407 TATCCAAGGCAGGGACTGAGGGG - Intergenic
1069861722 10:71475764-71475786 GCTGGAATGCAGGCCCTGAGGGG + Intronic
1076212795 10:128662498-128662520 CCTCCAAAGCAGAGCCTGAGGGG + Intergenic
1076943392 10:133625642-133625664 TCTGGAAATCAGGGTCTGTGGGG - Intronic
1077015305 11:396652-396674 TCTCGCTCTCAGGGCCTGAGTGG + Exonic
1085755197 11:79196225-79196247 TCTCGCAAGCCTGGACTGAGGGG + Intronic
1088000572 11:104875565-104875587 TCTCGAAACAATAGCCTGAGTGG - Intergenic
1090252068 11:125258671-125258693 TCTGAAAAACAGGGCCAGAGAGG + Intronic
1092145960 12:6214858-6214880 TCACGCAGGCAGGGCCTGGGTGG + Intronic
1095951600 12:47784643-47784665 TCAGGAAAGGAGGGCCTGGGAGG + Intronic
1097196191 12:57243572-57243594 TCTTGCAAGCGGGGCCTGAAAGG + Exonic
1099536973 12:83856907-83856929 TGTTGAAAGCAGGGCCTGGTGGG - Intergenic
1099983904 12:89640666-89640688 TGTTGAAAGCAGGGCCTAAGGGG + Intronic
1101754387 12:107609590-107609612 TCTCCATCCCAGGGCCTGAGAGG - Intronic
1102475671 12:113186687-113186709 CCTCGGAAGCAGGGCCTGGCCGG + Exonic
1102602301 12:114040798-114040820 TCTAGAATGCATGGTCTGAGTGG + Intergenic
1103926371 12:124425671-124425693 TCTCAAAAGCTGTGTCTGAGGGG - Intronic
1104045459 12:125159713-125159735 GCTGAAAAGCAGGCCCTGAGAGG - Intergenic
1104891459 12:132142176-132142198 TCTCGAAAGCAGGGCCTGAGGGG + Exonic
1110363117 13:74650300-74650322 TCTCAGCAGTAGGGCCTGAGAGG - Intergenic
1113472676 13:110557999-110558021 TCTGGAATCCAGGGCCTGCGGGG + Intronic
1113761038 13:112846808-112846830 TCACGAAGGCATGGCCTGAAAGG - Intronic
1114503739 14:23191986-23192008 TCTTGAATGCATGGCCTGAAAGG - Intronic
1117775713 14:59181787-59181809 TCTGCACAGCTGGGCCTGAGTGG + Intergenic
1118433215 14:65743563-65743585 TCTCAAAAGCAGGGCATGATAGG - Exonic
1120926740 14:89804564-89804586 TCTTGAAAGCAGAGCCTGATGGG - Intronic
1122270130 14:100565281-100565303 TCTCTACAGCAGGGACTGCGTGG + Intronic
1125528927 15:40398388-40398410 TCTTGATAGCTGGGCCAGAGAGG + Intergenic
1125601915 15:40919948-40919970 TCTGGAAAGCAGAGGGTGAGAGG + Intergenic
1132614839 16:835371-835393 CCTCTGAAGCTGGGCCTGAGGGG - Intergenic
1133042252 16:3066914-3066936 TCACAAGAGCAGGGCCTGCGTGG - Intronic
1133042263 16:3066954-3066976 TCACAAGAGCAGGGCCTGCGTGG - Intronic
1133042274 16:3066994-3067016 TCACAAGAGCAGGGCCTGCGTGG - Intronic
1133042285 16:3067034-3067056 TCACAAGAGCAGGGCCTGCGTGG - Intronic
1133042296 16:3067074-3067096 TCACAAGAGCAGGGCCTGCGTGG - Intronic
1133235151 16:4384238-4384260 TCCCTAATGCAGGGGCTGAGGGG - Intronic
1135323951 16:21514088-21514110 TCTCAGAAGAAGGGCCTGATGGG - Intergenic
1136335434 16:29607356-29607378 TCTCAGAAGAAGGGCCTGATGGG - Intergenic
1137567396 16:49542109-49542131 TCTGCAAGGCAGGGGCTGAGAGG - Intronic
1139692262 16:68648766-68648788 ACCAGAAAGCAGGGCCTGAGTGG + Intronic
1139719632 16:68842163-68842185 TTTGGAATGCAGGGCCTGAGAGG - Intergenic
1139911583 16:70400557-70400579 TCTTGAACACAGAGCCTGAGAGG - Exonic
1141304112 16:82845034-82845056 TCCTGAAATCAGAGCCTGAGAGG + Intronic
1143606109 17:7987229-7987251 TCTGGAAAGCAGGGGGAGAGTGG - Intergenic
1144848326 17:18231467-18231489 GGTGGACAGCAGGGCCTGAGGGG - Intronic
1145014968 17:19390724-19390746 TCTGGAAAGCAGGCCCTCAGTGG + Intergenic
1145062436 17:19741620-19741642 TCTGGAGAGCAGGCCCAGAGGGG - Intronic
1145877953 17:28334078-28334100 TCCCCAGAGCAGGGACTGAGTGG - Intronic
1148250226 17:46071896-46071918 TCTCCAAAGCAGGGCCCTAGGGG + Intronic
1149361702 17:55901957-55901979 TGTGGAAAGCAGGGCTTGGGAGG + Intergenic
1151810869 17:76440908-76440930 TCTAGAGGGCAGGGCCTGTGTGG + Intronic
1151877666 17:76876438-76876460 TCTAAATAGCAGGGCCTTAGAGG - Intronic
1153444070 18:5152780-5152802 TAACAAAAGCAGGGCCAGAGAGG + Intronic
1154071882 18:11159962-11159984 TCTTGAAAGCAGGGCTTTAAAGG + Intergenic
1155054654 18:22172353-22172375 TCCTGAAAACAGGGCCCGAGTGG - Intronic
1156881735 18:42088313-42088335 TCTGGAAAGCAGTGCCAGAGGGG - Intergenic
1157621973 18:49021867-49021889 TCCCGCAGGCAGGGCATGAGGGG + Intergenic
1161868285 19:6850772-6850794 TCTGGAAAGCTGGGATTGAGCGG - Intronic
1162929955 19:13952763-13952785 GCTCGGATGCAGGGCCTGGGCGG + Intronic
1167200384 19:48061259-48061281 TCTCGAAAGGAGGCCATGAGGGG + Intronic
925030020 2:643246-643268 TCTCGAATGGCGGGGCTGAGTGG - Intergenic
928425143 2:31171572-31171594 TCTCCAATGCAGGGACTCAGGGG - Intergenic
929864600 2:45707640-45707662 CCTCAAAAGCAGGGGCTGAGGGG - Intronic
933809865 2:86026580-86026602 TCCCATAAGCAGGGCCTGTGGGG + Exonic
941296245 2:163741804-163741826 GCTTGAAAGCACGGTCTGAGTGG - Intergenic
947722348 2:232377865-232377887 TCCAGAAAGCTCGGCCTGAGGGG + Intergenic
948830023 2:240594162-240594184 TCACGAGAGCAGGGACTCAGGGG - Intronic
1174273983 20:49390222-49390244 TTTCCAAAGCAGGTCCTTAGTGG - Intronic
1174391732 20:50221955-50221977 TATCGAATGCAGGGCAAGAGAGG - Intergenic
1176675472 21:9773088-9773110 TCTGGGAAGCAGTGCTTGAGAGG - Intergenic
1176874295 21:14113062-14113084 TTTTGAAAGCAGGACCTGAAAGG + Intronic
1181586971 22:23857979-23858001 ATTCGAAAGAGGGGCCTGAGCGG - Intronic
1182421849 22:30252449-30252471 TGTTGAAAGCAGGCCCAGAGGGG + Intergenic
1184602794 22:45553362-45553384 TCTGGAAACCAGGGCCTGCGTGG + Intronic
1185314079 22:50171267-50171289 TGTCACAAGCAGCGCCTGAGGGG + Intronic
950105543 3:10386144-10386166 TGGGGAGAGCAGGGCCTGAGGGG + Intronic
950221434 3:11199452-11199474 TGTCAAAATCAGGGCCTGAGGGG - Intronic
950405282 3:12800419-12800441 GCTGGAAAGCAGGGCCAGCGTGG + Intronic
951073412 3:18360379-18360401 CCTCGAAAACAGCCCCTGAGAGG - Intronic
954926043 3:54235585-54235607 TGTTGGAGGCAGGGCCTGAGGGG - Intronic
961306424 3:125961104-125961126 CCTCCAGACCAGGGCCTGAGGGG - Intergenic
961735781 3:129001527-129001549 TCTCGAAAGGAGGGGCTTAGCGG - Intronic
964526148 3:157616807-157616829 TGGGGAAAGCTGGGCCTGAGGGG - Intronic
973247471 4:48024643-48024665 ACTGGAAAGCAGGGCTTGTGGGG - Intronic
975800437 4:78055692-78055714 TTTAGAAAGTAGGGCCTGTGCGG - Intergenic
978621294 4:110636869-110636891 GCCCGAAAGCCGGGCCTGAGAGG + Intronic
978865861 4:113510097-113510119 TCTGGAAAGCAGGGCTTAAATGG - Intronic
983698420 4:170561355-170561377 TGCAGAAAGCAGGGCCAGAGAGG - Intergenic
985400076 4:189585609-189585631 TCTGGGAAGCAGTGCTTGAGAGG + Intergenic
985446746 4:190026104-190026126 TCTGGAAATCAGGGTCTGTGGGG - Intronic
989230705 5:39083314-39083336 TGTCGAAGGCAGGACCTGACGGG - Intergenic
989534324 5:42546475-42546497 TCTGGCAAGCAGGACCTGAATGG - Intronic
990613968 5:57488219-57488241 TCTCTAAAGCAGGCCAAGAGGGG + Intergenic
990866991 5:60390688-60390710 TCTCCAAGGCTTGGCCTGAGGGG + Intronic
997527294 5:134561598-134561620 CCTCAAAATCAGGGCCAGAGTGG - Intronic
999260971 5:150238847-150238869 TCTGGAAGGCAGAGCCTGTGAGG - Intronic
1001196205 5:169675710-169675732 GCTGGAACACAGGGCCTGAGGGG + Intronic
1002270258 5:178067197-178067219 TCGAGAATGCAGGGTCTGAGTGG + Intergenic
1007629435 6:43264679-43264701 CCTCGAAATCAGGGCAGGAGAGG + Intronic
1007680004 6:43627500-43627522 GCTCCAAAGCTGGGGCTGAGAGG + Intronic
1012374519 6:98545485-98545507 TATTGACATCAGGGCCTGAGAGG - Intergenic
1012904893 6:105052567-105052589 ACTGGAAAGCAGGGCCTAATAGG - Intronic
1019070421 6:169340795-169340817 TCTCCAATGCAGGGTCTGCGGGG + Intergenic
1019070434 6:169340847-169340869 TCTCCAATGCAGGGTCTGCGGGG + Intergenic
1019070460 6:169340951-169340973 TCTCCAATGCAGGGTCTGTGGGG + Intergenic
1024238716 7:47417130-47417152 TCTGGAGCGCTGGGCCTGAGGGG + Intronic
1026890729 7:73980390-73980412 TCTACAAAGCTGGGCCAGAGGGG + Intergenic
1027440559 7:78215089-78215111 TCACAAAAGCAGACCCTGAGAGG + Intronic
1027877218 7:83786587-83786609 TCTCCAAAGCAAGGGCTGACGGG + Intergenic
1028450123 7:90972834-90972856 TCTCAAAATCAGGTACTGAGGGG - Intronic
1029640745 7:101817387-101817409 TCTCGAAAGCAGAGCCCCGGGGG + Intronic
1035350455 7:158241928-158241950 TCTAGAAATATGGGCCTGAGGGG - Intronic
1036570775 8:9978092-9978114 TCTCGAACTCTGGGCCTGAAGGG + Intergenic
1037467830 8:19177349-19177371 TCTAGAAACCAGAGCATGAGAGG + Intergenic
1041564089 8:59256703-59256725 TCTTAAAAGCAAGGCCTGAAGGG - Intergenic
1043728708 8:83647335-83647357 TCTGGAAAGCAGGGACTGGAGGG - Intergenic
1044323305 8:90830861-90830883 TCTCTCAAGTAGGGCCTAAGAGG - Intronic
1045428230 8:102088117-102088139 TCTTGAAAGCAGGGCTTATGGGG - Intronic
1047512999 8:125529669-125529691 TCTACTGAGCAGGGCCTGAGAGG - Intergenic
1048529668 8:135235921-135235943 TCTGGAAAGCAGGGCGTGAGAGG - Intergenic
1051155114 9:14134232-14134254 TCCCTAGAGCAGTGCCTGAGTGG - Intronic
1051502090 9:17789010-17789032 TCTTGAAGACAGGGCCTGTGGGG + Intronic
1057775282 9:98003062-98003084 TCTGGAAGTCAGGGCCTGACTGG + Intronic
1057845367 9:98518588-98518610 CCGAGAAAGCAGGGCCTGGGAGG - Intronic
1059463474 9:114450289-114450311 CCTCGAAAGCAGGGGCAGTGTGG + Intronic
1059835726 9:118149992-118150014 TCTGAAAAGCAGGAGCTGAGTGG - Intergenic
1191616785 X:63177662-63177684 TCTGGAGAGCAGGCCTTGAGTGG + Intergenic
1191619512 X:63201261-63201283 TCTGGAGAGCAGGCCTTGAGTGG - Intergenic