ID: 1104894461

View in Genome Browser
Species Human (GRCh38)
Location 12:132155026-132155048
Sequence AATCGGGGGACGGGAGGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 403
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 368}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894461_1104894474 6 Left 1104894461 12:132155026-132155048 CCCTCTCCTCCCGTCCCCCGATT 0: 1
1: 0
2: 1
3: 33
4: 368
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109
1104894461_1104894472 -6 Left 1104894461 12:132155026-132155048 CCCTCTCCTCCCGTCCCCCGATT 0: 1
1: 0
2: 1
3: 33
4: 368
Right 1104894472 12:132155043-132155065 CCGATTCCGGGTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 57
1104894461_1104894477 13 Left 1104894461 12:132155026-132155048 CCCTCTCCTCCCGTCCCCCGATT 0: 1
1: 0
2: 1
3: 33
4: 368
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894461 Original CRISPR AATCGGGGGACGGGAGGAGA GGG (reversed) Intergenic
900585245 1:3429504-3429526 ACTCTGAGGACGGGATGAGATGG - Intronic
901036426 1:6338804-6338826 AGGCTGGGGACGGGAGGTGAGGG - Intronic
901209482 1:7516377-7516399 AATTGGGGGCTGGGAGGAGGAGG + Intronic
902072467 1:13751964-13751986 AATATGGGGAGGGGAGGGGAGGG - Intronic
902314413 1:15607175-15607197 AATCGGGGGATGGCAGTATATGG - Intergenic
903607479 1:24585442-24585464 ACTCAGGGGATGTGAGGAGAGGG - Intronic
903906773 1:26693420-26693442 AAGCGGGGGAGGGGAGGAGCTGG - Intergenic
904019391 1:27450827-27450849 AAGGGAGGGAAGGGAGGAGAAGG - Intronic
904469544 1:30727948-30727970 GATGGTGGGAGGGGAGGAGAGGG - Intergenic
905188909 1:36217842-36217864 AACAGGGAGACTGGAGGAGAAGG - Intergenic
905292965 1:36935527-36935549 AGATGGGGGAGGGGAGGAGAAGG - Intronic
907047251 1:51306854-51306876 AATCGGGGGGCGGGGGGGGGGGG - Intronic
907916820 1:58877892-58877914 AATAGGGAGACCCGAGGAGAGGG - Intergenic
908774994 1:67631146-67631168 AATGGAGGGAGGGAAGGAGAAGG + Intergenic
909339909 1:74520150-74520172 AATCGGGGAAAGGGTGGAAAGGG - Intronic
909365808 1:74820480-74820502 AATAGGGAGACTTGAGGAGAGGG + Intergenic
910806158 1:91191421-91191443 AAGCGGGGGAGCAGAGGAGATGG - Intergenic
911707929 1:101036521-101036543 AAATGGGGGAGGGGAGGAAAGGG + Intergenic
912756569 1:112329493-112329515 GATGGGGAGAGGGGAGGAGAGGG - Intergenic
912903546 1:113679246-113679268 GATGGGGGGAGGGAAGGAGAGGG - Intronic
913305397 1:117425096-117425118 AGGAGGGGGAAGGGAGGAGAAGG + Intronic
915536092 1:156536462-156536484 AGTCTGGGGAGGGTAGGAGAAGG + Intronic
916925213 1:169512301-169512323 AATGGGGGGTAGGGAAGAGATGG - Intergenic
917102714 1:171461799-171461821 AAGGAGGGGAGGGGAGGAGAGGG + Intergenic
917520375 1:175743337-175743359 AATAGGAGGAAGGGAAGAGAAGG - Exonic
918348956 1:183634981-183635003 TACCGGGGGGCGGGGGGAGATGG - Intronic
919912523 1:202120587-202120609 AGTTGGGGGAGGGGAGGGGAGGG - Intergenic
919915270 1:202135119-202135141 GATGGGGGAAAGGGAGGAGAGGG - Intronic
920013335 1:202886280-202886302 AAGCGGGGGAAGGGAGGGGAGGG + Intronic
921379529 1:214510111-214510133 AATAGGGAGGCGGGAGGAGAGGG + Intronic
921627727 1:217396531-217396553 ATTTGGGGGTGGGGAGGAGAGGG - Intergenic
923031224 1:230250418-230250440 AAGAGGGGGGAGGGAGGAGAGGG - Intronic
924321589 1:242855911-242855933 ACTCTGGGGACTGGGGGAGAAGG - Intergenic
924802458 1:247337439-247337461 AAGAGGGGGAGGGGAGGAGGAGG + Intergenic
1063264557 10:4433639-4433661 AATAGGGAGGCGTGAGGAGAAGG + Intergenic
1065593635 10:27291106-27291128 AAAGAGGGGAGGGGAGGAGAGGG - Intergenic
1066106324 10:32160521-32160543 AATAAGAGGATGGGAGGAGAGGG + Intergenic
1067039388 10:42940932-42940954 AAGCGGGGGAGGCGAGGACAGGG - Intergenic
1069367983 10:67713780-67713802 TGTCGGGGGATGGGAGGAAAGGG + Intergenic
1069721850 10:70554910-70554932 AGGAGGGGGAGGGGAGGAGAGGG - Intronic
1070830462 10:79415142-79415164 AATGGGAGGACGGGAGGGGCTGG - Intronic
1073379046 10:103063902-103063924 AATTAGGGCACAGGAGGAGATGG - Intronic
1074402268 10:113151909-113151931 AAGCGGGGGGCGGGTGGTGAGGG + Intronic
1075284472 10:121171753-121171775 ACTAGGGGGAAGGGAGGGGAAGG + Intergenic
1075358991 10:121812415-121812437 AATGGGGGGTGGGGAGAAGAAGG + Intronic
1075837667 10:125469512-125469534 AATCAGGGAGCGGGAGGAGAAGG + Intergenic
1076738345 10:132468542-132468564 AAGCAGGGGAGGGGAGGGGAGGG + Intergenic
1076738375 10:132468609-132468631 AGGCAGGGGAGGGGAGGAGATGG + Intergenic
1076738396 10:132468652-132468674 AAGCAGGGGAGGGGAGGGGAGGG + Intergenic
1076869325 10:133185821-133185843 GATCGTGGGAGGGGAGGAGAGGG + Intronic
1079364487 11:19797373-19797395 AATATGGGGATGGGAGGAGGTGG - Intronic
1080463412 11:32475273-32475295 AATGGGGGGACAGGAGTAGAAGG + Intergenic
1080582015 11:33651857-33651879 AAGGGGGGGAGGGGAGGGGAGGG - Intronic
1081569154 11:44278821-44278843 GACCTGGGGAGGGGAGGAGAGGG + Intronic
1082029844 11:47595908-47595930 AATGGTGGGAGGGGAGGGGAGGG + Intergenic
1082885717 11:58080135-58080157 TAGTGGGGGAAGGGAGGAGAGGG - Intronic
1083583298 11:63839017-63839039 AGTCTGTGGCCGGGAGGAGAAGG + Exonic
1083621432 11:64051258-64051280 AATCAGGGGAGGGGAGGGGCTGG + Intronic
1085238212 11:75031553-75031575 AGTCGGGGCACAGGAGGAGTGGG - Intergenic
1085530072 11:77187009-77187031 AATCAGGAGGCGTGAGGAGAGGG + Intronic
1086318611 11:85620310-85620332 AATAGGGGGACCTGAGGAGAGGG - Intronic
1088545923 11:110958790-110958812 GACTGGGGGACGGGAGGGGATGG + Intergenic
1088728326 11:112658789-112658811 AATCTGGGGAGGGGAGGGGAGGG - Intergenic
1088799608 11:113293509-113293531 AGGCGGGGGAGGGGAGGAGTTGG - Intergenic
1089012131 11:115139960-115139982 AGGTGGGGGACGTGAGGAGAGGG + Intergenic
1089227533 11:116938336-116938358 AAGAAGGGGACGGGAGGGGAGGG + Intronic
1089397913 11:118147838-118147860 AATCAGGGTCCTGGAGGAGATGG + Intronic
1089534689 11:119153841-119153863 TCTAGGGGGACGGGATGAGAGGG + Intronic
1090357618 11:126150487-126150509 AAGCGTGGGATGGGAGGAGAGGG + Intergenic
1091237446 11:134031573-134031595 AGACGGGGGAAGGCAGGAGAGGG - Intergenic
1091693197 12:2610902-2610924 AATGGAGAGAGGGGAGGAGATGG + Intronic
1091693208 12:2610967-2610989 AATGGAGAGAGGGGAGGAGATGG + Intronic
1091693219 12:2611032-2611054 AATGGAGAGAGGGGAGGAGATGG + Intronic
1091693233 12:2611097-2611119 AATGGAGAGAGGGGAGGAGATGG + Intronic
1091693247 12:2611162-2611184 AATGGGGAGAGGGGAGGAGATGG + Intronic
1091693260 12:2611227-2611249 AATGGAGAGAGGGGAGGAGATGG + Intronic
1091693272 12:2611292-2611314 AATGGAGAGAGGGGAGGAGATGG + Intronic
1091693299 12:2611420-2611442 AATGGGGAGAGGGGAGGAGATGG + Intronic
1091693320 12:2611506-2611528 AGTGGGGAGAGGGGAGGAGATGG + Intronic
1092211776 12:6651051-6651073 AGTGGGGAGAGGGGAGGAGAAGG + Exonic
1095375023 12:41516428-41516450 AATTGGGGGAGAGGAGAAGAAGG + Intronic
1095605175 12:44058952-44058974 GATCGGGGGATGGGTGGAGGTGG + Intronic
1095989270 12:48023134-48023156 ACTGGGGGGAGGGGAGGAGAAGG - Intronic
1096096306 12:48937954-48937976 CATTGGGGGAAGGGAGGCGAAGG - Exonic
1096822717 12:54249664-54249686 AAGCTGGGGGCGGGAGGAGGTGG + Intronic
1097716560 12:62972327-62972349 AATAGGGGGTGGGGAGCAGAAGG + Intergenic
1100550755 12:95644429-95644451 AATAAGGGGAAGGGAGAAGAAGG - Intergenic
1101580508 12:106037780-106037802 AAGAAGGGGAGGGGAGGAGAAGG - Intergenic
1102454950 12:113065500-113065522 AAAGGGGTGAGGGGAGGAGAAGG - Intronic
1102482462 12:113233188-113233210 GAAAGGGGGACGGGAAGAGATGG - Intronic
1102526414 12:113515313-113515335 ATTTGGGGGAAGGGAGGAGGAGG + Intergenic
1103191599 12:119006501-119006523 AATGGGGAGTCGGGAGCAGAAGG - Intronic
1103205032 12:119122210-119122232 AAACAGGGAAAGGGAGGAGAAGG + Intronic
1104178782 12:126357868-126357890 AGGGGAGGGACGGGAGGAGAGGG + Intergenic
1104894461 12:132155026-132155048 AATCGGGGGACGGGAGGAGAGGG - Intergenic
1105039918 12:132954334-132954356 GAGCTGGGGAGGGGAGGAGAAGG + Intronic
1105683421 13:22752571-22752593 AAGCGGGAGCGGGGAGGAGAGGG - Intergenic
1105846838 13:24300747-24300769 ACTTGGGGGAGGGGAGCAGAGGG - Intronic
1106016163 13:25870992-25871014 ATACGGGGGAAGGGAGGACAAGG - Intronic
1106668696 13:31881319-31881341 TATCAGGGGCTGGGAGGAGAAGG + Intergenic
1107314248 13:39114144-39114166 TATTGGGGGAGGGGAGGGGAGGG - Intergenic
1110214855 13:73014069-73014091 AAAAGGGGGAGGGGAGGAGAGGG - Intronic
1110552953 13:76828147-76828169 AAGGAGGGGAGGGGAGGAGAAGG + Intergenic
1112490004 13:99854246-99854268 AGTCGGGGGCTGGGAGGCGAAGG + Intronic
1114373377 14:22114639-22114661 TTTCGGGGGAGGGGAGGGGAAGG + Intergenic
1114458339 14:22871813-22871835 AAGCGGGGGAGGGGAAGAGGTGG - Exonic
1115816675 14:37171108-37171130 AAAGGGGGGAGGGGAGGGGAGGG + Intronic
1117107135 14:52409450-52409472 AATTGGGAGACGGGGGTAGAGGG - Intergenic
1117550620 14:56832579-56832601 AATCAGTGGGTGGGAGGAGAGGG - Intergenic
1118171872 14:63395992-63396014 AGACGGGGGAGGAGAGGAGAAGG + Intronic
1119033694 14:71212362-71212384 GCTCTGGGGAGGGGAGGAGATGG + Intergenic
1119174567 14:72559720-72559742 AGTCGGGGGAAGCGAGGAGCGGG + Intronic
1119519627 14:75276711-75276733 AAGAGGGGGACGGGAGGGAAAGG - Intergenic
1120828444 14:88976068-88976090 AATCAGGGGAGGGAAGGAGTGGG + Intergenic
1122473846 14:101991932-101991954 AGTGGGGGGTGGGGAGGAGAGGG - Intronic
1122789857 14:104179589-104179611 CAACTGGGGAGGGGAGGAGAGGG - Exonic
1124067245 15:26355693-26355715 TTTTGGGGGACAGGAGGAGATGG - Intergenic
1124957812 15:34371067-34371089 AAGAGGAGGAGGGGAGGAGAGGG - Intergenic
1125483059 15:40093575-40093597 CAGCTGGGGAGGGGAGGAGAGGG - Intronic
1125875346 15:43139323-43139345 AATGGGGAGGCTGGAGGAGAGGG - Intronic
1127909227 15:63402279-63402301 ACTCTGGGGATGGGAGCAGAGGG - Intergenic
1128226251 15:66003458-66003480 AATGGAGGGTGGGGAGGAGATGG + Intronic
1128254793 15:66188687-66188709 AGTAGGTGGAGGGGAGGAGAAGG - Intronic
1130951716 15:88596188-88596210 AAGGAGGGGAGGGGAGGAGAGGG - Intergenic
1132688048 16:1170463-1170485 AGCGGGTGGACGGGAGGAGATGG + Intronic
1132708859 16:1257834-1257856 CATCTGGGGAAGGGAGGGGAGGG - Intronic
1132744923 16:1432575-1432597 AAGCGTGGGACGCGCGGAGATGG + Intergenic
1133906205 16:10025062-10025084 AATCGAGAGATGAGAGGAGATGG + Intronic
1133964048 16:10518664-10518686 CATCGGGAGACGAGAGGAGTCGG - Intergenic
1135251546 16:20904474-20904496 AATAGGGGGCAGGGAGGAGAGGG - Intronic
1135905787 16:26510520-26510542 AGTTTGGGGATGGGAGGAGAAGG + Intergenic
1136382180 16:29900797-29900819 AAGCGGGGGTGGGGAGGAAAGGG + Exonic
1137497641 16:48983193-48983215 AAGAGGGGGAGGGGAGGGGAGGG - Intergenic
1138070902 16:53992148-53992170 AAAAGGGGGTTGGGAGGAGAGGG - Intronic
1138353201 16:56357688-56357710 CACCGGGAGCCGGGAGGAGAGGG - Intergenic
1138558702 16:57787534-57787556 AAGGGGAGGACGGGAGGACAAGG + Intronic
1139759298 16:69171615-69171637 AATTGGGGGAAGGGAAGGGAGGG + Intronic
1140557997 16:75943633-75943655 AATCGGGGGTGGGGTGGGGAGGG + Intergenic
1141233282 16:82191356-82191378 ATTGGGGGGAAGGGGGGAGAAGG - Intergenic
1141509697 16:84504522-84504544 AGTCGGGGGACTGGAGCAGACGG - Intronic
1141638889 16:85329818-85329840 AGGCTGGGGACGGGAGGGGAGGG + Intergenic
1141734753 16:85844792-85844814 AAGCAGAGGCCGGGAGGAGACGG - Intergenic
1141769749 16:86082619-86082641 AATGGGAGGATGGGAGGAGAGGG + Intergenic
1141928201 16:87183032-87183054 AAGCAGGGGCCGGGAGGAGAGGG - Intronic
1142410087 16:89911522-89911544 GATCTGGGCACGGGTGGAGAAGG + Intergenic
1142893635 17:2960825-2960847 AATCGGGTGACAGTATGAGACGG - Intronic
1143009105 17:3856034-3856056 AATTGGGGGGCGGGAGGTGGAGG + Intergenic
1143864287 17:9912619-9912641 AATCCAGGGATGGGAGGGGAAGG - Intronic
1144147222 17:12410536-12410558 AAACAGGGGCGGGGAGGAGAGGG - Intergenic
1144764114 17:17723700-17723722 ACTCGGGGGAAGGGAGGAGGAGG - Intronic
1146123738 17:30216287-30216309 GAGCGGGGGAGGGGAGGGGAGGG + Intronic
1146255911 17:31391592-31391614 AATAGGGGGCGGGGAGGGGAGGG - Intergenic
1146521180 17:33526762-33526784 TTTCTGGGGAGGGGAGGAGAAGG - Intronic
1146687511 17:34851107-34851129 AATAGGGGGAGGGGCGGGGAGGG + Intergenic
1146687528 17:34851149-34851171 AATAGGGGGAGGGGCGGGGAGGG + Intergenic
1147514265 17:41101537-41101559 AATGAGGGGAGGGGAGGGGAGGG + Exonic
1147738851 17:42659148-42659170 GAACGGGGGAGGGGAGGAAAGGG - Intergenic
1148115554 17:45172710-45172732 CATGTGGGGAGGGGAGGAGAGGG + Intergenic
1149512592 17:57256174-57256196 GATCGGGGGAGGGGAGGCGCGGG - Intronic
1150270626 17:63862197-63862219 ATTTGGGTGAGGGGAGGAGAGGG + Intergenic
1150274253 17:63885719-63885741 ATTTGGGTGAGGGGAGGAGAGGG + Intergenic
1150276399 17:63900546-63900568 ATTTGGGTGAGGGGAGGAGAGGG + Intergenic
1150488287 17:65559108-65559130 TATCGGGGGAGGGGAAGGGAGGG - Intronic
1150726730 17:67657137-67657159 AAACGGGGGTGGGGAGGGGAAGG - Intronic
1151291176 17:73151177-73151199 AGACGGGGGAAGAGAGGAGAGGG + Intergenic
1152356458 17:79809975-79809997 AATGGGGGGGCAGGGGGAGAGGG + Intergenic
1153287894 18:3473230-3473252 AATAGGGAGACCCGAGGAGAGGG - Intergenic
1154465650 18:14641291-14641313 AAGCGGGAGAGGGGAAGAGAGGG - Intergenic
1154465658 18:14641318-14641340 AAGCGGGAGAGGGGAAGAGAGGG - Intergenic
1154465666 18:14641345-14641367 AAGCGGGAGAGGGGAAGAGAGGG - Intergenic
1155058251 18:22204415-22204437 GAGGGGGGGAGGGGAGGAGAGGG - Intergenic
1156581292 18:38379525-38379547 GGTCGGGAGAAGGGAGGAGAGGG + Intergenic
1157455728 18:47827467-47827489 AAGTGGGAGACGGGGGGAGACGG - Exonic
1157630721 18:49092756-49092778 AATCTGGGGACAGAAGGAGAAGG + Intronic
1160864561 19:1251051-1251073 CATCGGGGGAGGGGCGGAGGGGG + Intronic
1160992255 19:1864545-1864567 GATAGGGGGACGGGAAGAGGGGG + Intergenic
1161621417 19:5299250-5299272 AATGGAGGGCAGGGAGGAGATGG - Intronic
1161643169 19:5436678-5436700 AAGGGGGGAAGGGGAGGAGAGGG - Intergenic
1162173138 19:8807214-8807236 AATCTGGAGACGAGAGGAGAGGG - Exonic
1162216706 19:9140556-9140578 GATCGGGGGAGCGGAGGTGACGG - Exonic
1162309939 19:9900258-9900280 AACCTGGGAAGGGGAGGAGAGGG + Intronic
1162924517 19:13923504-13923526 AGTCGAGGGAAGGGAAGAGAGGG - Intronic
1163054013 19:14705243-14705265 AATTGGGGGAGGGGAGGGAAAGG + Intronic
1163551451 19:17968062-17968084 TATTGGGGGAGGGGAGGGGAAGG + Intronic
1164144796 19:22505357-22505379 AGTCGTGGGTGGGGAGGAGAAGG - Intronic
1164439205 19:28259218-28259240 AATAGGTGGGAGGGAGGAGAGGG + Intergenic
1165158674 19:33803238-33803260 AATCAGGGGACAGGAGGCCAGGG + Intronic
1165407455 19:35639371-35639393 CATAGGGTCACGGGAGGAGATGG + Intergenic
1165811460 19:38614349-38614371 ATTCTGGGGATGGGAGGGGAGGG - Intronic
1167636603 19:50659337-50659359 AGTCAGGGGAAGGGAGGTGATGG + Intronic
1168083797 19:54029990-54030012 AAATGGGGGAGGGGGGGAGAGGG + Intergenic
1168472691 19:56652259-56652281 AAGCTGGAGAGGGGAGGAGAGGG + Intronic
925969403 2:9096218-9096240 AAGTGAGGGAGGGGAGGAGAAGG + Intergenic
926349732 2:11983945-11983967 AAGCGGGAGACAGTAGGAGATGG - Intergenic
926391215 2:12394873-12394895 AAGCGAGAGACAGGAGGAGAAGG - Intergenic
927554083 2:24020442-24020464 CCTCTGGGGAGGGGAGGAGAGGG - Intronic
928387647 2:30883927-30883949 AATTGGGAGGAGGGAGGAGAGGG + Intergenic
929242548 2:39666651-39666673 AACCGGGGAATGGGAGGCGAAGG - Intronic
931789953 2:65656108-65656130 AATTGGGGGCTGGGAAGAGAAGG - Intergenic
933992099 2:87641071-87641093 AAAGGTGGGAGGGGAGGAGAGGG + Intergenic
935225167 2:101046679-101046701 AGTGGGGGGAGGGGAGGAAAGGG + Intronic
935264989 2:101386809-101386831 AGTCGGGGGAGGGTCGGAGAGGG - Intronic
935789797 2:106580559-106580581 AAGAAGGGGACGGGAGGGGAGGG - Intergenic
936103614 2:109604712-109604734 ACTCTGGGGAGGGGAGGGGAGGG + Intronic
936301745 2:111309747-111309769 AAAGGTGGGAGGGGAGGAGAGGG - Intergenic
937065122 2:119011808-119011830 ACTAGGGGGTCGGAAGGAGAGGG - Intergenic
937791438 2:125966881-125966903 AATCTGAGGAAGGGAGAAGAAGG - Intergenic
938087766 2:128412471-128412493 AGTGGTGGGACGGGAGGGGACGG + Intergenic
938455195 2:131456919-131456941 AAGCGGGGGACGGGGGCGGAGGG + Intergenic
939704780 2:145439280-145439302 AATAGAGAGACTGGAGGAGAGGG + Intergenic
940205435 2:151196891-151196913 AAACAGGAGAAGGGAGGAGAGGG - Intergenic
941420237 2:165275334-165275356 AATCAGGGTTGGGGAGGAGAAGG - Intronic
942457493 2:176148215-176148237 GATCGGGGGAGGGGCGGGGAAGG - Intergenic
943811522 2:192194804-192194826 AGCCGGAGGACAGGAGGAGACGG + Exonic
945251752 2:207770103-207770125 AATCGCGGGCCTGGAGGAGATGG + Intergenic
946299983 2:218817034-218817056 AATAAGGGGAAGGGAAGAGAAGG + Intergenic
946357504 2:219197514-219197536 AATGGGGGGTGGGGAGGACAGGG - Intronic
946920540 2:224576686-224576708 AAGGGGGGGGGGGGAGGAGAAGG + Intronic
948023641 2:234758220-234758242 CATGGGGGGACAGGAGGAGATGG - Intergenic
948614554 2:239190210-239190232 AAGAGGGGGACAGGGGGAGAGGG - Intronic
1168831148 20:845905-845927 TATTGGGGGAGGGGAGGAGGGGG - Exonic
1169226151 20:3858235-3858257 AACCAGGGGAGGGGAAGAGAAGG - Intronic
1170247067 20:14233013-14233035 AATAGGGAGGCTGGAGGAGAGGG + Intronic
1170761369 20:19254216-19254238 ACTCTGGGGTCGGGAGTAGATGG - Intronic
1170851737 20:20011127-20011149 AATGGTGGGAGGGGAGGGGAGGG - Intergenic
1171001658 20:21421920-21421942 AGTAGGGGAAGGGGAGGAGAGGG - Intergenic
1171209886 20:23309195-23309217 AATGGGGGAAGGGGAGGAGGAGG - Intergenic
1172041706 20:32051241-32051263 GGTCGGGGGAGGGGAGGAGTCGG - Intergenic
1174387893 20:50197946-50197968 GAGCGGGGGAGGGGAGGATAGGG + Intergenic
1174926579 20:54766854-54766876 GATCGGAGGAGGGGAGGGGAGGG - Intergenic
1175210561 20:57351378-57351400 AAGCGGCGGCCGGGAGCAGAAGG - Exonic
1175332558 20:58175431-58175453 AAACGGGGAACAGGAGGGGATGG + Intergenic
1175649598 20:60707866-60707888 AATAGGGGGGCTTGAGGAGAGGG - Intergenic
1176114943 20:63428140-63428162 GTTCGGGGGACGGGCAGAGAGGG - Intronic
1176257218 20:64158732-64158754 AGTAGGGGGAGGGGAGGGGATGG - Intronic
1177834020 21:26170428-26170450 AAGCGGGGGCGGAGAGGAGAGGG + Intronic
1178049352 21:28731126-28731148 AGTTGGGGGAAGGGAGAAGAGGG + Intergenic
1179062365 21:37990773-37990795 AATCGGGGGGTGGGAGGAAGAGG - Intronic
1179296501 21:40067704-40067726 AATGAGGGGAGGGGAGGGGAGGG - Intronic
1179350975 21:40610585-40610607 TATTGGGGGAGGGGAGGGGATGG - Intronic
1179511375 21:41876363-41876385 AATAAGGAGACGGGAGCAGAAGG + Intronic
1179951385 21:44710607-44710629 TATCAGGGGAGGCGAGGAGATGG - Intronic
1181772622 22:25137284-25137306 AATCAGGGAACAGGAGGACATGG + Intronic
1182483163 22:30622778-30622800 GATCGGGGGTCTGGAGGGGAAGG + Intronic
1183090454 22:35518768-35518790 AAAAGGGGGAGGGGAGGAGACGG - Intergenic
950644261 3:14367699-14367721 GATGCGGGGAGGGGAGGAGAGGG + Intergenic
951235883 3:20236071-20236093 AAACTGGGGAAGGGAGGGGAAGG - Intergenic
953205336 3:40822766-40822788 AAGCAGGGCAGGGGAGGAGAAGG - Intergenic
954156207 3:48686126-48686148 AAGCGGGGAAAGGGAGCAGAGGG - Intronic
955573025 3:60328070-60328092 AATCAGAGGACTGGAGCAGAAGG - Intronic
956088212 3:65636125-65636147 AAGAGGGATACGGGAGGAGAGGG + Intronic
957138307 3:76318426-76318448 AATTTGGAAACGGGAGGAGAGGG - Intronic
958920199 3:100096621-100096643 AGTAGGGGGTGGGGAGGAGATGG + Intronic
959542822 3:107559405-107559427 AGTTGGGGGACTGAAGGAGAGGG + Intronic
959989503 3:112615500-112615522 CATCGGGGGAGGGGAGGGGAAGG + Intronic
960474835 3:118110888-118110910 AAGCGGGGGAGGGGAGGGGATGG + Intergenic
962071013 3:132034196-132034218 AATCGGGGAAGGGGAGGGGAAGG - Intronic
965520156 3:169662860-169662882 GATGGGGGGCCGGCAGGAGAAGG - Intronic
966305226 3:178525329-178525351 TATCTGGGGAAAGGAGGAGAAGG - Intronic
967470195 3:189851977-189851999 AAACAGGGAACGGGAGGAAAGGG + Intronic
968484351 4:851771-851793 GATCGGGGCGCGGGAGGAGCGGG - Exonic
968889212 4:3359010-3359032 AAGAGGGGGAGGGGAGGAGGAGG - Intronic
968937258 4:3617661-3617683 AAGGGAGGGAAGGGAGGAGAAGG - Intergenic
968976093 4:3822779-3822801 AAAGGAGGGGCGGGAGGAGAAGG - Intergenic
968985035 4:3870327-3870349 CATTGGGGAAAGGGAGGAGATGG + Intergenic
969370323 4:6727648-6727670 AGGAGGGGGAGGGGAGGAGAAGG - Intergenic
969550976 4:7867055-7867077 AAAGAGGGGAGGGGAGGAGAAGG + Intronic
969828618 4:9778112-9778134 ACTCGGGGGAGGCGGGGAGAAGG - Intronic
971412127 4:26384992-26385014 AAAGGGGGGAGGGGAGGAGAGGG - Intronic
972621438 4:40751061-40751083 AATGAGGGGAAGGGAGGAGGAGG - Intronic
975633076 4:76421240-76421262 AGTTGGGGGAGGGGAGGAGGGGG + Intronic
975884065 4:78943463-78943485 AAGGAGGGGAGGGGAGGAGAGGG - Intergenic
977002423 4:91519922-91519944 AATTGGGGGAAGGGACAAGATGG - Intronic
978620689 4:110632542-110632564 GAGCCGGGGACGGGAGGAGGGGG + Intronic
981200643 4:141975483-141975505 AATAGGGACACGTGAGGAGAGGG - Intergenic
981776221 4:148370844-148370866 ATTGGGGGGCGGGGAGGAGAAGG - Intronic
981973486 4:150694683-150694705 TATGGGGGGAAGGGAGGAGGGGG - Intronic
982677785 4:158395803-158395825 AATCAGGGGACAGGGGGAGATGG + Intronic
983006976 4:162495154-162495176 TAGCAGGGGACGGGAGGAAAGGG + Intergenic
983568107 4:169175818-169175840 AATTGGGGGATGGGGGGAGAGGG - Intronic
984043918 4:174773790-174773812 ATTTGGGGGAAGGGAAGAGAAGG - Intronic
984051556 4:174870944-174870966 AAAAGGGGGATGGGAGGTGAGGG - Intronic
984216567 4:176920404-176920426 ATTTGTGGGAAGGGAGGAGAAGG + Intergenic
985104174 4:186485388-186485410 AACGGGGGGAAGGGAGGGGAGGG - Intronic
985330476 4:188826391-188826413 AATTGGGAGGCTGGAGGAGAGGG - Intergenic
986067925 5:4254208-4254230 GATGGGGGGAGTGGAGGAGAAGG + Intergenic
986094437 5:4540908-4540930 CATCTGGAAACGGGAGGAGATGG - Intergenic
987142239 5:14958235-14958257 AAGGAGGGGAGGGGAGGAGAGGG - Intergenic
987194030 5:15507049-15507071 ATTCAAGGGAAGGGAGGAGAAGG + Intronic
988198821 5:28044859-28044881 AATCAGGAGAAGGGAGGATATGG + Intergenic
988485438 5:31664858-31664880 AACTGGTGGAAGGGAGGAGATGG + Intronic
988857889 5:35246999-35247021 AATGGGGGAAGGGGAGGGGAAGG + Intergenic
990040980 5:51378616-51378638 GAGCGGGGGAGGGGAGGCGAAGG - Intergenic
990640123 5:57773975-57773997 TATCTGAGGACGGGAGTAGATGG - Intergenic
990760929 5:59128292-59128314 AATAGGAGGTTGGGAGGAGAAGG + Intronic
991143125 5:63269767-63269789 AATAGGGAGACCTGAGGAGAGGG + Intergenic
991413191 5:66365624-66365646 AATAGGGAGACCAGAGGAGAGGG + Intergenic
991540340 5:67720581-67720603 AGTGAGGGGAGGGGAGGAGAGGG - Intergenic
992210919 5:74478713-74478735 AATCCAGGTAGGGGAGGAGACGG - Intergenic
992400101 5:76403766-76403788 AATTGGGGGGCGGGAGGAGCGGG - Intronic
992484937 5:77185709-77185731 GGTGGGGGGACAGGAGGAGATGG - Intergenic
992664539 5:78994119-78994141 AATTGGGGGAGGGGAGGACTTGG + Intergenic
994155573 5:96499984-96500006 AATAGGGAGACCAGAGGAGAGGG + Intergenic
994997227 5:107079129-107079151 AAAAGGGGAAGGGGAGGAGAGGG + Intergenic
996403287 5:123085657-123085679 AGGAGGGGGGCGGGAGGAGAAGG - Intergenic
996560390 5:124822005-124822027 AAAAGGTGGAGGGGAGGAGAGGG + Intergenic
997225767 5:132208417-132208439 GAGGGGGGGAGGGGAGGAGAGGG + Intronic
999514915 5:152291428-152291450 AATAGGGGGGCCTGAGGAGAGGG - Intergenic
999796459 5:154993795-154993817 AAGGGAGGGAGGGGAGGAGAGGG - Intergenic
1000990638 5:167908343-167908365 AGAGGGGGGAGGGGAGGAGAGGG - Intronic
1001036472 5:168300289-168300311 AATGGGGTGGCGGGAGGAGGGGG + Intronic
1001373131 5:171227021-171227043 AATAGGGAGTGGGGAGGAGAAGG - Intronic
1001706033 5:173741732-173741754 GATAGGGGGACAGGGGGAGAGGG + Intergenic
1002273272 5:178086690-178086712 AACCCCGGGACGGGACGAGATGG - Intergenic
1002666968 5:180831980-180832002 ATTCTGGGGAGGGGAGGAGGAGG - Intergenic
1003141729 6:3477494-3477516 GCTCGGGGGGCGGGAGGTGATGG + Intergenic
1003513874 6:6802861-6802883 AATCGGGAGAGGGGAGATGAGGG + Intergenic
1003619989 6:7691332-7691354 AAGGAGGGGAAGGGAGGAGAGGG - Intergenic
1003691512 6:8359010-8359032 AATCTGGGGAAGGCAGGGGAAGG - Intergenic
1004551586 6:16653264-16653286 AAGAGGCGGACGGAAGGAGAGGG + Intronic
1005425862 6:25701865-25701887 GATCGGGGGAATGGTGGAGAAGG + Intergenic
1007336018 6:41155723-41155745 AAAGGTGAGACGGGAGGAGATGG - Intergenic
1011083327 6:83512426-83512448 AGTGGGGGGAGGGGAGGAGGAGG - Intergenic
1012965069 6:105665258-105665280 AATAGGGAGCCGTGAGGAGAGGG + Intergenic
1015100087 6:129467353-129467375 AAAAGGGGGGAGGGAGGAGAAGG + Intronic
1015113382 6:129619327-129619349 AAAAGGGGGAGGGGAGGACAGGG + Intronic
1015208893 6:130672875-130672897 GATGAGGGGGCGGGAGGAGAGGG - Intergenic
1015454233 6:133407364-133407386 AATGGGAGGATAGGAGGAGAAGG + Intronic
1015976272 6:138794536-138794558 AATTGGGGGAGGGGAGGAGAGGG + Intergenic
1016324363 6:142882625-142882647 AAGGGGGGGAGGGGAGGGGAGGG + Intronic
1016390977 6:143574821-143574843 AATTGGGGGAGAGGAGGAGAAGG - Intronic
1018149748 6:160926597-160926619 AATCTGGGTGCGGGAGGAGAGGG + Intergenic
1018429693 6:163713396-163713418 AGTGGGGGGAGGGGAGGAGTTGG - Intergenic
1018447314 6:163869685-163869707 AATTGGGGGAGGGGAGGGCAGGG - Intergenic
1018798880 6:167207606-167207628 AGTTGGGGGAGGGTAGGAGAGGG + Intergenic
1018981010 6:168601827-168601849 CATCGATGGACGGGAAGAGAGGG - Intronic
1019751606 7:2734215-2734237 ACACGGGGCACGGGAGGAGCCGG + Intronic
1024471337 7:49770887-49770909 AAAGGGGGGATGGGAAGAGAAGG + Intergenic
1026086939 7:67270494-67270516 AACCCGGGGAGGGGAGGGGAGGG - Intergenic
1026690163 7:72544204-72544226 AACCTGGGGAGGGGAGGGGAGGG + Intergenic
1027188765 7:75986263-75986285 AATAGGGGGCAGGGAGGACAAGG + Intronic
1027397121 7:77767731-77767753 AAAGGGGGGAGGGGAGGGGAGGG - Intronic
1027428213 7:78083002-78083024 TATCGGGGGACAGCAGGAGGTGG + Intronic
1027609117 7:80337601-80337623 GATCAGAGGAGGGGAGGAGAGGG + Intergenic
1028472972 7:91224433-91224455 GATCTGGGGATGGGATGAGAAGG + Intergenic
1028567193 7:92246204-92246226 ACTCGGGGGAGGGGAAGAGGGGG - Intergenic
1028768596 7:94589269-94589291 AATGTGGGGACTGAAGGAGAGGG - Intronic
1028986268 7:97011096-97011118 AATGGGGGGAAGGGAAGTGAGGG - Intergenic
1028990872 7:97047377-97047399 AGTTGGGGGAAGGGAGGAGTAGG + Intergenic
1029456526 7:100674908-100674930 AATCGGGGGATGGGGGGTGCGGG - Intronic
1029728507 7:102424425-102424447 AAGAGGGGGAGGGGAGGAGTTGG + Intronic
1030028646 7:105349158-105349180 AAGAGGGGGAGGGGAGGGGAGGG + Intronic
1030738908 7:113085467-113085489 AATGGGGGGTAGGGTGGAGAGGG - Intronic
1030783100 7:113625794-113625816 AAGGAGGGGAGGGGAGGAGAGGG - Intergenic
1032061332 7:128727740-128727762 CATCGGGGGAAGGGAGTGGATGG - Intronic
1033912868 7:146285929-146285951 AAAAGGGGGAGGGGAGGGGAAGG - Intronic
1033969778 7:147025335-147025357 AAAGGGGGGAGGGGAGGGGAGGG + Intronic
1034028168 7:147730597-147730619 AATAGGGGGTCTTGAGGAGAGGG - Intronic
1034422047 7:150995587-150995609 AGGCAGGGGACGGGGGGAGAGGG - Intronic
1035387083 7:158480405-158480427 AATAGGGAGGCTGGAGGAGAGGG - Intronic
1035435920 7:158858971-158858993 AAGGGGGGGAGGGGAGGAAAGGG - Intronic
1035770174 8:2140756-2140778 AATCGGGGGGAGTGAAGAGATGG + Exonic
1037760184 8:21736905-21736927 AATGAGGGGAGGGGAGGGGAGGG + Intronic
1040436189 8:47393902-47393924 AAGCAGGGGATGGGAGGGGAGGG - Intronic
1041586432 8:59525590-59525612 AATAGGGAGACCTGAGGAGAGGG - Intergenic
1042952422 8:74214975-74214997 AATGGGGGGAGGGGAGGAAGGGG - Intergenic
1045809496 8:106204956-106204978 GATTGGAGGATGGGAGGAGAGGG - Intergenic
1047131245 8:122022624-122022646 AAAGAGGGGAGGGGAGGAGAGGG - Intergenic
1048836632 8:138524959-138524981 AATGGGAGGAAGGGAGGACAAGG - Intergenic
1049240551 8:141535558-141535580 AGTCGGGGAGCGGGAGGAGGAGG - Intergenic
1049610535 8:143552935-143552957 AGTGGGGGGAGGGGAGGGGAGGG + Intergenic
1049784494 8:144444102-144444124 GATCGGGGGCCGGGGGGCGACGG - Intronic
1050494915 9:6230546-6230568 AAGCGGGGGATGGGAGCACAGGG - Intronic
1050952115 9:11610768-11610790 AAATAGGGGAAGGGAGGAGAGGG - Intergenic
1051387218 9:16522154-16522176 AAAAGGGGGGCAGGAGGAGAGGG + Intronic
1051403711 9:16711093-16711115 ACTGGGGGGAGGGGAGGAGGAGG - Intronic
1051642740 9:19238573-19238595 AGGAGGGGGAGGGGAGGAGAGGG - Intronic
1053329372 9:37188959-37188981 AGTGGGGAGAGGGGAGGAGATGG - Intronic
1054453888 9:65420011-65420033 AAGGGAGGGATGGGAGGAGAAGG + Intergenic
1055812828 9:80169951-80169973 AATAGGGAGACTTGAGGAGAAGG + Intergenic
1056879042 9:90371537-90371559 AATAGGGAGACCTGAGGAGAAGG - Intergenic
1059768438 9:117405542-117405564 AAACTGGGGACAGGAGGAGTTGG - Intronic
1061382264 9:130265655-130265677 GATTGGGGGAGGGGAGGAGGCGG + Intergenic
1062212518 9:135372598-135372620 AAGCGCCGGACGGGAGGAGCGGG - Intergenic
1062314023 9:135956675-135956697 AATCGTGGGGTGAGAGGAGAGGG + Intronic
1185511663 X:668310-668332 AAGTGGGGGAGGGGAGGGGAGGG - Intergenic
1185640712 X:1588278-1588300 AAGGAGGGGAGGGGAGGAGAGGG - Intergenic
1185640881 X:1588624-1588646 AAGGAGGGGAGGGGAGGAGAGGG - Intergenic
1186265083 X:7823850-7823872 AATGTGGGGACGGCAGGATATGG - Intergenic
1187187952 X:17005462-17005484 AAAAGGGGGAAGGGAGGAGGTGG - Intronic
1188236788 X:27741334-27741356 GCTCTGGGGAGGGGAGGAGAGGG - Intronic
1188591757 X:31845425-31845447 AAGAGAGGGACGGGAGGAGAGGG - Intronic
1189300445 X:39948583-39948605 AATAGAGGGACTGCAGGAGAGGG - Intergenic
1189705001 X:43750921-43750943 AATCTGGGGAAAGCAGGAGAAGG + Intergenic
1190069020 X:47264025-47264047 AAGTGGGGGAAGGGAGCAGATGG - Intergenic
1192190787 X:68990072-68990094 AATGGGGGGCCAGGAGGAGCTGG - Intergenic
1192313366 X:70034144-70034166 AATGGGGGAACGGAAGTAGATGG - Intronic
1192446934 X:71217937-71217959 AATCCTGGGACAGAAGGAGAGGG + Intronic
1192751713 X:73998878-73998900 AAGGGGGGGAGGGGAGGGGAGGG - Intergenic
1193579599 X:83248173-83248195 ATTAGGGGTAGGGGAGGAGATGG - Intergenic
1194959797 X:100222186-100222208 AATTGGGGGAGGGAAGGACAGGG + Intergenic
1196719318 X:118839278-118839300 TTTCGGGGGAAGGGAGGAAAGGG + Intergenic
1197482233 X:127001748-127001770 AATAGGGGGATGAGAAGAGAAGG - Intergenic