ID: 1104894462

View in Genome Browser
Species Human (GRCh38)
Location 12:132155027-132155049
Sequence GAATCGGGGGACGGGAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 457}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894462_1104894474 5 Left 1104894462 12:132155027-132155049 CCTCTCCTCCCGTCCCCCGATTC 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109
1104894462_1104894472 -7 Left 1104894462 12:132155027-132155049 CCTCTCCTCCCGTCCCCCGATTC 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1104894472 12:132155043-132155065 CCGATTCCGGGTCTCCCTTCAGG 0: 1
1: 0
2: 0
3: 1
4: 57
1104894462_1104894477 12 Left 1104894462 12:132155027-132155049 CCTCTCCTCCCGTCCCCCGATTC 0: 1
1: 0
2: 1
3: 33
4: 457
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894462 Original CRISPR GAATCGGGGGACGGGAGGAG AGG (reversed) Intergenic
900088216 1:908654-908676 GAGTAGGGGGAGGGGATGAGGGG + Intergenic
900182093 1:1315679-1315701 GAGGCGGGGGACGGGAAGCGCGG + Intronic
900579721 1:3403085-3403107 GAGGCGGGGGAAGGGAGGGGAGG - Intronic
901022395 1:6261803-6261825 GAATGGGAGGAGGGGAGGAGGGG - Intergenic
901065621 1:6492897-6492919 GGAGAAGGGGACGGGAGGAGGGG - Intronic
901279090 1:8018362-8018384 GAAGCGGGGGGCGGGGGGGGGGG + Intronic
902072468 1:13751965-13751987 GAATATGGGGAGGGGAGGGGAGG - Intronic
902251405 1:15156011-15156033 GAATGGGGGAGCTGGAGGAGAGG + Intronic
902342698 1:15794301-15794323 GAATGGGGGGATGGGGAGAGGGG + Intergenic
902450135 1:16491441-16491463 GAATGGGGGGAGGAAAGGAGGGG + Intergenic
902630435 1:17701462-17701484 GATTCGGTGGAGGGAAGGAGGGG + Intergenic
903607480 1:24585443-24585465 GACTCAGGGGATGTGAGGAGAGG - Intronic
904040528 1:27581887-27581909 GACTCAGGGGAGGGGAAGAGAGG - Intronic
904218504 1:28944222-28944244 GAGGCGGGGGCTGGGAGGAGAGG + Intronic
905015263 1:34773851-34773873 AATTGGGGGGACGGTAGGAGGGG + Intronic
906509149 1:46401044-46401066 AAACCAGGGGAGGGGAGGAGGGG + Intronic
906509190 1:46401133-46401155 GAGTAGGGGGAGGGGAGTAGGGG + Intronic
906631759 1:47375855-47375877 GAATCGGGGAAAGGGAGGTTAGG - Intronic
907047252 1:51306855-51306877 CAATCGGGGGGCGGGGGGGGGGG - Intronic
908510601 1:64847488-64847510 GAAACGGGAGAGGGGAGGGGAGG + Intronic
909339910 1:74520151-74520173 GAATCGGGGAAAGGGTGGAAAGG - Intronic
909365807 1:74820479-74820501 GAATAGGGAGACTTGAGGAGAGG + Intergenic
911995303 1:104758247-104758269 GAATGGGGGGAGGAGGGGAGGGG + Intergenic
912511987 1:110195763-110195785 GAAAGGTGGGATGGGAGGAGGGG + Intronic
912651311 1:111441977-111441999 GAATCAGGGAAGGGGAGCAGTGG - Intronic
915182141 1:154071441-154071463 GACTCGGGGGAAAGGTGGAGGGG - Intronic
915616651 1:157044529-157044551 AAAGCGGGGGAGGGGAAGAGGGG - Exonic
916666627 1:166973608-166973630 GCATCGGGGGGGGGGGGGAGGGG - Intronic
918026804 1:180758332-180758354 GAGACGGGGAAGGGGAGGAGGGG + Intronic
918040540 1:180911921-180911943 GTACCGGGGCAGGGGAGGAGGGG - Intergenic
919915271 1:202135120-202135142 GGATGGGGGAAAGGGAGGAGAGG - Intronic
920013334 1:202886279-202886301 AAAGCGGGGGAAGGGAGGGGAGG + Intronic
921379528 1:214510110-214510132 GAATAGGGAGGCGGGAGGAGAGG + Intronic
922314969 1:224434425-224434447 GAGGCGGGGGAGGGGAGGCGGGG + Intronic
923031225 1:230250419-230250441 GAAGAGGGGGGAGGGAGGAGAGG - Intronic
923646838 1:235831203-235831225 GAAGCGGGTGAAGGGAGGTGAGG - Intronic
924329187 1:242925333-242925355 GAGGCGGGGGAGGGGAGGAAAGG - Intergenic
924365608 1:243290194-243290216 GGATCGGGGGGCGGGAGCGGTGG - Intronic
1063643409 10:7854653-7854675 TAATGGGGGGGCGGGGGGAGGGG + Intronic
1065099688 10:22321146-22321168 GAGCGGGGGGAGGGGAGGAGGGG - Intronic
1065593636 10:27291107-27291129 GAAAGAGGGGAGGGGAGGAGAGG - Intergenic
1066106323 10:32160520-32160542 GAATAAGAGGATGGGAGGAGAGG + Intergenic
1067233645 10:44428503-44428525 GACTAGGGGAACGGGTGGAGGGG - Intergenic
1067495415 10:46756816-46756838 GAACCGGGGGAGGGGAGCTGGGG - Intergenic
1067599238 10:47583572-47583594 GAACCGGGGGAGGGGAGCTGGGG + Intergenic
1067948899 10:50710157-50710179 GAACCGGGGGAGGGGAGCTGGGG + Intergenic
1068716290 10:60192688-60192710 GAAAGGTGGGACGGTAGGAGTGG + Intronic
1069666309 10:70162465-70162487 GAGGCGGGGCAGGGGAGGAGGGG + Intronic
1069666317 10:70162479-70162501 GAGGAGGGGGAGGGGAGGAGGGG + Intronic
1069721851 10:70554911-70554933 GAGGAGGGGGAGGGGAGGAGAGG - Intronic
1069875620 10:71561303-71561325 GAAAGGGGGGCAGGGAGGAGGGG - Intronic
1070316428 10:75317570-75317592 GAAATGGGGGCCGGGAGCAGTGG - Intergenic
1070670820 10:78376231-78376253 GAATTGGGGCTCGGGAGGGGTGG - Intergenic
1070765426 10:79053513-79053535 GACTCGGGGGGCGGGGGGCGGGG + Intergenic
1070884217 10:79875149-79875171 GAACCGGGGGAGGGGAGCTGGGG + Intergenic
1071650771 10:87391449-87391471 GAACCGGGGGAGGGGAGCTGGGG + Intergenic
1071663001 10:87524725-87524747 GAATAGGGAGACTGGAGGAGAGG + Intronic
1072409191 10:95184379-95184401 GAATGGGGGGACGGCGGGGGTGG + Intergenic
1074402267 10:113151908-113151930 GAAGCGGGGGGCGGGTGGTGAGG + Intronic
1075467467 10:122662393-122662415 GAGTGGGTGGAGGGGAGGAGAGG - Intergenic
1075559281 10:123456713-123456735 GAATTGGGGGCTGGGAGAAGGGG + Intergenic
1076018765 10:127052884-127052906 GAATAAGGGGACGAGAGAAGGGG - Intronic
1076489331 10:130846257-130846279 GAAACTGGTGAGGGGAGGAGAGG - Intergenic
1076614079 10:131744837-131744859 GCATGGGAGGACGGGAGGATGGG + Intergenic
1076869324 10:133185820-133185842 TGATCGTGGGAGGGGAGGAGAGG + Intronic
1077016039 11:399524-399546 GAAAAGGGGGACAGGTGGAGGGG - Intronic
1077357758 11:2126610-2126632 GAATGGGTGGATGGGTGGAGGGG + Intergenic
1077462494 11:2717613-2717635 GAATATGGGGATGGGAGGATTGG - Intronic
1077698664 11:4419044-4419066 GATTTGGGGTAGGGGAGGAGTGG + Intergenic
1077725993 11:4675556-4675578 GCATCTGGGGCCGGGAGCAGTGG - Intergenic
1078325488 11:10377413-10377435 GAAGTGGGGGAAGGGAGGAAGGG + Intronic
1078597265 11:12698207-12698229 GAAGCGGGGACCGGGAGGTGAGG + Intronic
1078809852 11:14747693-14747715 GTATTGGGGGAGGGAAGGAGGGG + Intronic
1080387073 11:31816661-31816683 GAAACGGGGGACGAGCGCAGTGG - Intronic
1080588470 11:33700988-33701010 GAGTCGAGGGACGGGAGGCGAGG - Intronic
1081569153 11:44278820-44278842 GGACCTGGGGAGGGGAGGAGAGG + Intronic
1081864566 11:46352482-46352504 GCCTCAGGGGACGGGAGGGGTGG - Intronic
1084937618 11:72595508-72595530 GAGAGGGGGGAGGGGAGGAGGGG - Intronic
1085238213 11:75031554-75031576 TAGTCGGGGCACAGGAGGAGTGG - Intergenic
1085431615 11:76455547-76455569 GAGTGGGGGGAGGGGAGGGGAGG - Intronic
1085530071 11:77187008-77187030 GAATCAGGAGGCGTGAGGAGAGG + Intronic
1085740547 11:79074818-79074840 GAAGCGGAGGCCTGGAGGAGGGG - Intronic
1086318612 11:85620311-85620333 GAATAGGGGGACCTGAGGAGAGG - Intronic
1086737894 11:90329848-90329870 GAAGGAGAGGACGGGAGGAGGGG - Intergenic
1088521915 11:110711048-110711070 GAAGCGGGGGTGGGGAGGCGGGG + Intronic
1088728327 11:112658790-112658812 AAATCTGGGGAGGGGAGGGGAGG - Intergenic
1089012130 11:115139959-115139981 GAGGTGGGGGACGTGAGGAGAGG + Intergenic
1089619083 11:119712329-119712351 GAACTGGGGGAGGGGAGGGGAGG - Intronic
1090357617 11:126150486-126150508 CAAGCGTGGGATGGGAGGAGAGG + Intergenic
1090924623 11:131238586-131238608 GAATTGGGGGTGGGAAGGAGGGG + Intergenic
1091237447 11:134031574-134031596 GAGACGGGGGAAGGCAGGAGAGG - Intergenic
1091618482 12:2067640-2067662 GAAGCAGGGGATGGGAGGACTGG + Intronic
1091843832 12:3639332-3639354 GAATCGGGGAACTGGATGTGGGG + Intronic
1092250943 12:6896124-6896146 GAATCGCTTGACGGGAGCAGAGG + Intronic
1094118094 12:26938722-26938744 AAATCCAGGGACGGGAGCAGGGG + Intronic
1095707604 12:45254342-45254364 GAATAGGGGGAGAGGAGGATGGG + Intronic
1095922899 12:47548614-47548636 GAATAGGGAGGCTGGAGGAGAGG + Intergenic
1096836273 12:54353334-54353356 GAAGGGGGAGAGGGGAGGAGGGG - Intergenic
1096854748 12:54472678-54472700 GAATGGGGGGAGGGGTGGTGAGG - Intronic
1098443403 12:70541616-70541638 GGATCGCGGGGAGGGAGGAGTGG - Intronic
1098774060 12:74588942-74588964 GGAGAGGGGGACGGGGGGAGGGG + Intergenic
1098991001 12:77065244-77065266 CAGCCGGGGGACGTGAGGAGTGG + Intronic
1099613326 12:84904202-84904224 GAAAGGGGGGAGGGGCGGAGGGG + Intronic
1101155753 12:101925980-101926002 GAATCTGGGGCCGGGCGCAGTGG - Intronic
1101205089 12:102478808-102478830 GAGTCGGGGGAAGGGAGTAAGGG - Intronic
1102253819 12:111405219-111405241 GAATTGGGGGACAGGACGGGCGG + Intergenic
1102301571 12:111775294-111775316 GAGCCTGGGGACAGGAGGAGTGG - Intronic
1102521629 12:113480747-113480769 GAAGCGGGGGGCGGGGGGACTGG + Intergenic
1102565545 12:113794993-113795015 GAATAGGGGGAAGGAGGGAGGGG + Intergenic
1102653724 12:114462418-114462440 GAATGGGCAGAGGGGAGGAGTGG - Intergenic
1104311501 12:127657753-127657775 GAAGCGGGGGAAGTGAGGTGGGG - Intergenic
1104894462 12:132155027-132155049 GAATCGGGGGACGGGAGGAGAGG - Intergenic
1110214856 13:73014070-73014092 AAAAAGGGGGAGGGGAGGAGAGG - Intronic
1110357433 13:74584154-74584176 GAAGCGGGGAAGGGGAGCAGGGG + Intergenic
1112336958 13:98523977-98523999 GAATTGTGGGACAGGAAGAGTGG - Intronic
1112506907 13:99981088-99981110 GAGCAGGGGGAGGGGAGGAGGGG - Intergenic
1113420989 13:110171305-110171327 GAATGGGGAGAGGGCAGGAGGGG + Intronic
1113909716 13:113836327-113836349 GAGGAGGGGGAGGGGAGGAGGGG + Intronic
1116808605 14:49517950-49517972 GAAGGGTGGGAGGGGAGGAGGGG + Intergenic
1116928465 14:50667160-50667182 GCAGCGGGGGACCGGAGGTGGGG + Intronic
1117550621 14:56832580-56832602 GAATCAGTGGGTGGGAGGAGAGG - Intergenic
1117958387 14:61140260-61140282 GAAGCGGGGAAGGGGAGGATGGG - Intergenic
1118697031 14:68395205-68395227 GAATCGGGCAAAGAGAGGAGAGG - Intronic
1119172313 14:72544748-72544770 GAACAGGGGGATGGAAGGAGGGG - Intronic
1119174566 14:72559719-72559741 CAGTCGGGGGAAGCGAGGAGCGG + Intronic
1119472046 14:74906399-74906421 GAATCGGGGGTGGGGGGGTGGGG + Exonic
1120414937 14:84207474-84207496 GAAAAGGGGGAAGGGAGGAAGGG - Intergenic
1120828443 14:88976067-88976089 AAATCAGGGGAGGGAAGGAGTGG + Intergenic
1122274298 14:100583601-100583623 GGATAGATGGACGGGAGGAGAGG - Intronic
1202834128 14_GL000009v2_random:65203-65225 GAATCGGGGGTGGGGAGGGTTGG + Intergenic
1123677644 15:22726750-22726772 GAATGAGGGGCCGGGAGCAGTGG - Intergenic
1124329846 15:28801014-28801036 GAATGAGGGGCCGGGAGCAGTGG - Intergenic
1124957813 15:34371068-34371090 GAAGAGGAGGAGGGGAGGAGAGG - Intergenic
1124957827 15:34371114-34371136 GAAGAGGAGGAGGGGAGGAGGGG - Intergenic
1125178684 15:36856685-36856707 GAAGGGGGGGACGGGAGGGAAGG - Intergenic
1125483060 15:40093576-40093598 GCAGCTGGGGAGGGGAGGAGAGG - Intronic
1125875347 15:43139324-43139346 GAATGGGGAGGCTGGAGGAGAGG - Intronic
1126077215 15:44923120-44923142 GAATCAGGGGAGGGGAGGATGGG - Intergenic
1126081500 15:44967745-44967767 GAATCAGGGGAGGGGAGGATGGG + Intronic
1127117303 15:55741971-55741993 GAATGGGGTGACGGTAGGAGAGG - Intronic
1128411916 15:67408000-67408022 CCATCTGGGGACTGGAGGAGAGG + Intronic
1128655563 15:69458983-69459005 GAATGGGGGGCCGGGTGCAGCGG - Intergenic
1130071074 15:80647435-80647457 GACTGGGCGGCCGGGAGGAGGGG - Intergenic
1130994829 15:88897877-88897899 GCAGCGTGGGACTGGAGGAGGGG - Intergenic
1131026876 15:89150525-89150547 TTTTCGGGGGAGGGGAGGAGGGG - Intronic
1131366426 15:91845847-91845869 GGAACGGGGGAGTGGAGGAGAGG - Intergenic
1132692327 16:1187189-1187211 GAATGAGGGGCCGGGAGGGGAGG + Intronic
1132799186 16:1743307-1743329 GAAATGGGGGGCGAGAGGAGAGG - Intronic
1132868423 16:2104917-2104939 GAAAAAGGGGAGGGGAGGAGGGG + Intronic
1133495755 16:6315451-6315473 GAATCGGTGGATGGGTGGATGGG + Intronic
1134266943 16:12700887-12700909 GAACCTGGGGTGGGGAGGAGGGG + Intronic
1135066590 16:19315047-19315069 GAAAAGAGGGAAGGGAGGAGGGG + Intronic
1135066612 16:19315104-19315126 GAAAGGAGGGAAGGGAGGAGGGG + Intronic
1135251547 16:20904475-20904497 CAATAGGGGGCAGGGAGGAGAGG - Intronic
1135375663 16:21944773-21944795 GAATTGGGGGAGTGGAGGAGAGG + Intergenic
1136345574 16:29673447-29673469 GAAGCCGGGGAAGGGAGGACGGG + Intronic
1136375403 16:29862522-29862544 GAGGCAGGGGAAGGGAGGAGGGG + Intronic
1136403503 16:30030733-30030755 GAGACGGGGGAGGGGAGGATGGG + Exonic
1137497642 16:48983194-48983216 GAAGAGGGGGAGGGGAGGGGAGG - Intergenic
1137510831 16:49098654-49098676 AAATAGGGGGAAGGAAGGAGAGG + Intergenic
1137788293 16:51154309-51154331 GGAGGGGGGGATGGGAGGAGGGG + Intergenic
1137871520 16:51954567-51954589 GAGTCGGGGGGAGGGAGGAAGGG - Intergenic
1138333262 16:56231976-56231998 GAATGTGGGGGCTGGAGGAGGGG + Intronic
1138353202 16:56357689-56357711 GCACCGGGAGCCGGGAGGAGAGG - Intergenic
1138421281 16:56900945-56900967 GGATTAGGGGAAGGGAGGAGGGG - Intronic
1138539600 16:57680101-57680123 GAATATAGGGAGGGGAGGAGAGG - Intronic
1140566496 16:76049003-76049025 AAATTGGGGGAGGGGAGGCGAGG + Intergenic
1141371096 16:83486993-83487015 GAAGGAGGGGAAGGGAGGAGAGG + Intronic
1141499189 16:84431889-84431911 GAAGCGGGGGCTGGGAGGAAGGG + Intronic
1141754165 16:85980207-85980229 GGATGGGAGGAAGGGAGGAGTGG + Intergenic
1141769748 16:86082618-86082640 CAATGGGAGGATGGGAGGAGAGG + Intergenic
1141928202 16:87183033-87183055 AAAGCAGGGGCCGGGAGGAGAGG - Intronic
1142161377 16:88559328-88559350 GGCTGGGGGGAGGGGAGGAGAGG + Intergenic
1143137633 17:4720565-4720587 GGCTGGGGGGACGGGAAGAGGGG - Exonic
1145817797 17:27808013-27808035 GAATTGGAGGAAGGGAGGAAGGG + Intronic
1145986767 17:29052232-29052254 GGATCAGGGGACAGGAGGAAGGG + Intronic
1146123737 17:30216286-30216308 GGAGCGGGGGAGGGGAGGGGAGG + Intronic
1146362317 17:32186997-32187019 GAAGCGGGGGCCGGGTGCAGTGG + Intronic
1146475151 17:33156831-33156853 GACTGGGGAGACGGGAGGAAGGG + Intronic
1146687510 17:34851106-34851128 GAATAGGGGGAGGGGCGGGGAGG + Intergenic
1146687527 17:34851148-34851170 GAATAGGGGGAGGGGCGGGGAGG + Intergenic
1147738852 17:42659149-42659171 GGAACGGGGGAGGGGAGGAAAGG - Intergenic
1148115553 17:45172709-45172731 GCATGTGGGGAGGGGAGGAGAGG + Intergenic
1148687005 17:49506667-49506689 GGTTCGGGGGGCGGGGGGAGTGG + Intronic
1148853154 17:50564502-50564524 GAGTCGGGGGAGGAGAGGGGGGG + Intronic
1148984955 17:51613302-51613324 GAGGAGGGGGACGGGAGAAGGGG - Intergenic
1149045848 17:52244486-52244508 GTATCATGGGACTGGAGGAGAGG - Intergenic
1149512593 17:57256175-57256197 GGATCGGGGGAGGGGAGGCGCGG - Intronic
1150210518 17:63438828-63438850 GCAGCTGGGGATGGGAGGAGAGG + Intronic
1150214294 17:63458014-63458036 GACTGGGGGGACGAGAAGAGGGG + Intergenic
1150488288 17:65559109-65559131 GTATCGGGGGAGGGGAAGGGAGG - Intronic
1150645258 17:66973848-66973870 GAATTGGGGGACGGGACGTTGGG - Intronic
1151159259 17:72151006-72151028 GAAAAGGAGGAGGGGAGGAGGGG + Intergenic
1151291175 17:73151176-73151198 GAGACGGGGGAAGAGAGGAGAGG + Intergenic
1151678900 17:75613853-75613875 GTCTCAGGGGCCGGGAGGAGAGG + Intergenic
1152248308 17:79197903-79197925 GAGTCGGGGGAGGTGAGGAAGGG - Intronic
1152336003 17:79700546-79700568 GGAGCGGGGGACAGGATGAGGGG + Intergenic
1153287895 18:3473231-3473253 GAATAGGGAGACCCGAGGAGAGG - Intergenic
1153729021 18:7988562-7988584 GACTAGGTGGAGGGGAGGAGTGG - Intronic
1154317621 18:13318059-13318081 GAAGCGAGGGACCGGACGAGTGG - Intronic
1155212928 18:23618813-23618835 GAATTGGGGGGCGGGGGGTGGGG + Intronic
1155490422 18:26395970-26395992 GAATCTAGGGAGGGGAGCAGGGG - Intergenic
1155928665 18:31684621-31684643 GAGTCGGGGGAGGGGAGGCGCGG + Exonic
1156016283 18:32550744-32550766 GAATGGTGGGCCGGGAGCAGTGG - Intergenic
1157544861 18:48540080-48540102 GGAGCGGGGGATGGGAGCAGAGG + Intronic
1158067299 18:53425647-53425669 GAATAGGGGGCCAGGAGCAGTGG - Intronic
1158889560 18:61860130-61860152 GAAGCTGGGGAAGGGAGGAAGGG + Intronic
1159586542 18:70288684-70288706 GACTCTGGGGGCCGGAGGAGCGG + Intergenic
1160550454 18:79691533-79691555 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160550469 18:79691571-79691593 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160550512 18:79691683-79691705 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160550527 18:79691721-79691743 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160550582 18:79691871-79691893 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160550612 18:79691947-79691969 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160550627 18:79691985-79692007 GACTCGGGGTGGGGGAGGAGTGG + Intronic
1160864560 19:1251050-1251072 CCATCGGGGGAGGGGCGGAGGGG + Intronic
1160891380 19:1380532-1380554 GAATTGGGGAAGGTGAGGAGGGG - Intergenic
1160983279 19:1826471-1826493 GAGATGGGGGAAGGGAGGAGGGG + Intronic
1160992254 19:1864544-1864566 GGATAGGGGGACGGGAAGAGGGG + Intergenic
1161010829 19:1958713-1958735 GGATGGGGGGACGAGGGGAGGGG - Intronic
1161030721 19:2056679-2056701 GAAGGGGTGGAAGGGAGGAGAGG - Intergenic
1161307730 19:3577168-3577190 GGAAGGGGGGAAGGGAGGAGGGG - Intronic
1161487567 19:4544028-4544050 GAAGCGGAGGCCGGGAGCAGGGG + Exonic
1161501877 19:4620703-4620725 GAATGGGAGGATGGGAGGTGGGG + Intergenic
1161640751 19:5421188-5421210 GGGGTGGGGGACGGGAGGAGAGG + Intergenic
1161643170 19:5436679-5436701 GAAGGGGGGAAGGGGAGGAGAGG - Intergenic
1161879417 19:6937437-6937459 GGAGAGGGGGATGGGAGGAGGGG - Intronic
1162145715 19:8611212-8611234 GAAGTGGGGGCCTGGAGGAGGGG + Intergenic
1162173139 19:8807215-8807237 GAATCTGGAGACGAGAGGAGAGG - Exonic
1162461761 19:10817767-10817789 GGGTCGGGGGTGGGGAGGAGGGG + Intronic
1162549707 19:11351644-11351666 AAGTCGGGGGACAGGAGGTGGGG + Intronic
1162604267 19:11694758-11694780 GGATCCCGAGACGGGAGGAGGGG - Intergenic
1162689063 19:12413917-12413939 GGGTCCGGAGACGGGAGGAGGGG - Intronic
1162924518 19:13923505-13923527 GAGTCGAGGGAAGGGAAGAGAGG - Intronic
1163023390 19:14495764-14495786 CAGCCGGGGGACGGGGGGAGGGG + Intronic
1163090460 19:15016066-15016088 GACTGGGGGGTGGGGAGGAGGGG + Intronic
1164439204 19:28259217-28259239 GAATAGGTGGGAGGGAGGAGAGG + Intergenic
1165327466 19:35122702-35122724 GAATGGGGGGACAGATGGAGAGG + Intronic
1165811461 19:38614350-38614372 GATTCTGGGGATGGGAGGGGAGG - Intronic
1166876722 19:45902135-45902157 GAATGGGGGCACGGGAGGATAGG + Intronic
1167418019 19:49387033-49387055 GAGTGGGGGAAGGGGAGGAGAGG + Intergenic
1167649160 19:50719967-50719989 GACTCGGAGGTGGGGAGGAGTGG - Intergenic
1167955149 19:53058206-53058228 AAAGCGCGGGGCGGGAGGAGGGG + Intergenic
1168083796 19:54029989-54030011 GAAATGGGGGAGGGGGGGAGAGG + Intergenic
1168472690 19:56652258-56652280 GAAGCTGGAGAGGGGAGGAGAGG + Intronic
1168639828 19:58023789-58023811 GAGTCGGGGGGCGGGGGGGGTGG - Intergenic
1202638553 1_KI270706v1_random:62489-62511 GAATCGGGGGTGGGGAGGGTTGG - Intergenic
925012729 2:497711-497733 GAAGCGGGGGGCGCGAGAAGAGG - Intergenic
926310172 2:11669464-11669486 GAGTCGGGGGAGGGGGGGTGGGG - Intronic
927142365 2:20139257-20139279 GAAGAAGGGGAAGGGAGGAGAGG - Intergenic
927193386 2:20532086-20532108 GAATCCTGGGCCGGGAGCAGAGG + Intergenic
927554085 2:24020443-24020465 GCCTCTGGGGAGGGGAGGAGAGG - Intronic
929195405 2:39179715-39179737 GAATCGAGGCACTGGAGGTGGGG + Intronic
930719621 2:54626607-54626629 GTATGGGGAGAAGGGAGGAGTGG + Intronic
931348770 2:61470703-61470725 GAAGCGGGGGAGGGGGGGGGCGG - Exonic
932331381 2:70900283-70900305 GGAACGGTGGAGGGGAGGAGAGG + Intergenic
933666808 2:84971102-84971124 GGGCCGGGGGAGGGGAGGAGCGG + Exonic
935225166 2:101046678-101046700 GAGTGGGGGGAGGGGAGGAAAGG + Intronic
935430110 2:102966767-102966789 GACTGGGGGGACAGGAGGTGGGG + Intergenic
936103613 2:109604711-109604733 GACTCTGGGGAGGGGAGGGGAGG + Intronic
938128257 2:128690085-128690107 GAAGAGGGGGAGTGGAGGAGTGG + Intergenic
938218912 2:129548834-129548856 GAATCGGGGGTCTGGAAGTGTGG - Intergenic
938278775 2:130050444-130050466 GAATCGTGGGAGGGGAGGCCTGG - Intergenic
938329749 2:130441303-130441325 GAATCGTGGGAGGGGAGGCCTGG - Intergenic
938360197 2:130680200-130680222 GAATCGTGGGAGGGGAGGCCTGG + Intergenic
938436600 2:131286908-131286930 GAATCGTGGGAGGGGAGGCCTGG + Intronic
938568322 2:132540325-132540347 GCATCAGGGGAGGGGAGGAGAGG + Intronic
939704779 2:145439279-145439301 GAATAGAGAGACTGGAGGAGAGG + Intergenic
940973799 2:159921800-159921822 GACCCGGGGGACGGTAGTAGGGG + Intergenic
942002368 2:171661363-171661385 GACTGGGGAGAGGGGAGGAGTGG - Intergenic
942370231 2:175276098-175276120 GAATGGGGGAAATGGAGGAGGGG - Intergenic
943614816 2:190081203-190081225 GGATGGGGGGATGGGAGGATGGG - Intronic
945111659 2:206366140-206366162 GAATGGGAGGAAGGGAGGAAGGG - Intergenic
947136343 2:226979967-226979989 GAATTTGGGGACAGGACGAGTGG + Intronic
947448013 2:230179478-230179500 GACTGGGGGGCAGGGAGGAGTGG + Intronic
947745119 2:232503369-232503391 GAGTGCGGGGACGGGAGGAGGGG + Intergenic
948856312 2:240732116-240732138 GGATGAGGGGAGGGGAGGAGGGG + Intronic
948920497 2:241063949-241063971 GAGTCTGGGGGAGGGAGGAGAGG - Intronic
1168831149 20:845906-845928 GTATTGGGGGAGGGGAGGAGGGG - Exonic
1169680407 20:8205788-8205810 GAATAGGGGCATGGGAGAAGGGG + Intronic
1170247066 20:14233012-14233034 GAATAGGGAGGCTGGAGGAGAGG + Intronic
1171001659 20:21421921-21421943 GAGTAGGGGAAGGGGAGGAGAGG - Intergenic
1171902283 20:30868904-30868926 GAGTCGGGGGAAGAGAGGGGTGG - Intergenic
1172919212 20:38467504-38467526 GAATTTGGGGCCGGGAGGTGGGG - Intergenic
1174387892 20:50197945-50197967 GGAGCGGGGGAGGGGAGGATAGG + Intergenic
1174926580 20:54766855-54766877 GGATCGGAGGAGGGGAGGGGAGG - Intergenic
1175531112 20:59674724-59674746 GAAGGGGGGAACAGGAGGAGGGG - Intronic
1175531151 20:59674861-59674883 GAAGCGGGGGACAGGAGAAGGGG - Intronic
1175600159 20:60266609-60266631 GACTCAGGGGAGGGAAGGAGGGG - Intergenic
1175649599 20:60707867-60707889 GAATAGGGGGGCTTGAGGAGAGG - Intergenic
1176114944 20:63428141-63428163 GGTTCGGGGGACGGGCAGAGAGG - Intronic
1178824639 21:36004980-36005002 GAGGCAGGGGAAGGGAGGAGGGG + Intergenic
1179296502 21:40067705-40067727 GAATGAGGGGAGGGGAGGGGAGG - Intronic
1179626824 21:42653731-42653753 GAGGCGGGGGAGGGGAGCAGGGG - Intronic
1180363413 22:11919399-11919421 GAATCGGGGGTGGGGAGGGTTGG + Intergenic
1180837487 22:18937496-18937518 GAGGTGGAGGACGGGAGGAGTGG + Intergenic
1181959436 22:26612324-26612346 GAATTGGGGGATGGGAGGACAGG - Intronic
1182661130 22:31926024-31926046 TGATGGGGGGAGGGGAGGAGTGG + Intergenic
1183486102 22:38088605-38088627 GGTGCGGGGGTCGGGAGGAGAGG + Intronic
1184089885 22:42287056-42287078 GGCTGGGGGGAAGGGAGGAGGGG + Intronic
1184677883 22:46053607-46053629 GACTCTGGGGACGGGAGGCAGGG + Intronic
1185130818 22:49037593-49037615 GGATTGGGGAGCGGGAGGAGGGG + Intergenic
1203287580 22_KI270734v1_random:162795-162817 GAGGTGGAGGACGGGAGGAGTGG + Intergenic
949947481 3:9202059-9202081 GGATGGGGGGAAGGGAGGCGGGG + Intronic
950176407 3:10877925-10877947 GAGTCGGGGGTCAGGTGGAGTGG - Intronic
951912406 3:27765240-27765262 AAATCTGGGGTGGGGAGGAGAGG - Intergenic
952488256 3:33837873-33837895 GAATGAGGGGCCGGGAGCAGTGG - Intronic
952805642 3:37348616-37348638 GTATTGGGGGTGGGGAGGAGAGG + Intronic
953048233 3:39314966-39314988 GATTCAGGGCAGGGGAGGAGGGG + Intergenic
953947762 3:47163973-47163995 GACGCGGGGGAGGGGAGGGGAGG + Intergenic
954302649 3:49708375-49708397 GAAGCTGGGGAAGGGAGGACAGG - Intronic
954347242 3:50010390-50010412 GAGTCGGGGGGTGGCAGGAGAGG + Intronic
955977066 3:64489572-64489594 GAAGGTGGGGAGGGGAGGAGAGG + Intergenic
956088211 3:65636124-65636146 GAAGAGGGATACGGGAGGAGAGG + Intronic
959776618 3:110172184-110172206 GAATCGGAGGACATGATGAGAGG + Intergenic
960044999 3:113188191-113188213 GAATAGGGAGACCTGAGGAGAGG - Intergenic
960062149 3:113334339-113334361 GAATCTGGGGACAGAGGGAGAGG - Intronic
961543511 3:127616829-127616851 GAAGCGGGGGAGGGGGAGAGTGG - Intronic
962809204 3:138947040-138947062 AAACCGGGGGGCGGGGGGAGGGG - Exonic
962834413 3:139174371-139174393 GAATCGGAGGGTGGTAGGAGAGG - Intronic
967470194 3:189851976-189851998 GAAACAGGGAACGGGAGGAAAGG + Intronic
967712373 3:192723962-192723984 GAAGGAGGGGAGGGGAGGAGAGG + Intronic
967987704 3:195107553-195107575 GAAGAGGGGGAGAGGAGGAGGGG + Intronic
968479009 4:825793-825815 GAAACGGGGGCCGGAGGGAGAGG + Intronic
968484352 4:851772-851794 TGATCGGGGCGCGGGAGGAGCGG - Exonic
968542114 4:1172919-1172941 GACAGGGGGGAGGGGAGGAGGGG - Intronic
968698009 4:2042159-2042181 GAGTCGGGGAACCGGAGGTGGGG + Intronic
969537821 4:7767574-7767596 GAGTCTGGGGAAGGGAGGAATGG - Intronic
969668085 4:8573740-8573762 GCAGCGGGGGAGGGGAAGAGGGG + Intronic
969996009 4:11313994-11314016 GATTTGGGGCACAGGAGGAGAGG + Intergenic
971382312 4:26110264-26110286 GCATAGGGGGACAGGAGGAGGGG + Intergenic
971412128 4:26384993-26385015 GAAAGGGGGGAGGGGAGGAGAGG - Intronic
972385864 4:38564773-38564795 GAAAAGGGGGCCGGGCGGAGGGG - Intergenic
972714525 4:41632439-41632461 GGATCTGGGGTGGGGAGGAGGGG + Intronic
975633075 4:76421239-76421261 TAGTTGGGGGAGGGGAGGAGGGG + Intronic
975884066 4:78943464-78943486 GAAGGAGGGGAGGGGAGGAGAGG - Intergenic
978620688 4:110632541-110632563 GGAGCCGGGGACGGGAGGAGGGG + Intronic
978813700 4:112878908-112878930 GAATCAGGGGCCGGGCGCAGTGG - Intronic
981200644 4:141975484-141975506 GAATAGGGACACGTGAGGAGAGG - Intergenic
981973487 4:150694684-150694706 TTATGGGGGGAAGGGAGGAGGGG - Intronic
981994797 4:150963782-150963804 GACTGGGGGGCCGGGCGGAGGGG - Intronic
983568108 4:169175819-169175841 GAATTGGGGGATGGGGGGAGAGG - Intronic
984070380 4:175103515-175103537 GAGTAGGGAGAAGGGAGGAGTGG + Intergenic
985104175 4:186485389-186485411 GAACGGGGGGAAGGGAGGGGAGG - Intronic
985330477 4:188826392-188826414 GAATTGGGAGGCTGGAGGAGAGG - Intergenic
1202765892 4_GL000008v2_random:148348-148370 GAATCGGGGGTGGGGAGGGTTGG - Intergenic
986175699 5:5350212-5350234 AAATCGGGGGAACCGAGGAGTGG - Intergenic
986622090 5:9686596-9686618 AGATGGGGGGAAGGGAGGAGAGG + Intronic
989762055 5:45027660-45027682 GAATAGGGAGACCCGAGGAGAGG - Intergenic
990584741 5:57200133-57200155 GAAGCAGGGGAGGGGAGGGGCGG - Intronic
991143124 5:63269766-63269788 GAATAGGGAGACCTGAGGAGAGG + Intergenic
991413190 5:66365623-66365645 GAATAGGGAGACCAGAGGAGAGG + Intergenic
992400102 5:76403767-76403789 GAATTGGGGGGCGGGAGGAGCGG - Intronic
992672121 5:79070603-79070625 GAATGGGAGGAAGGGAGGAGGGG + Intronic
992884959 5:81149478-81149500 GAAGGGTGGGAGGGGAGGAGGGG + Intronic
993383162 5:87231690-87231712 GAATCCCAGGATGGGAGGAGAGG - Intergenic
994155572 5:96499983-96500005 GAATAGGGAGACCAGAGGAGAGG + Intergenic
994997226 5:107079128-107079150 GAAAAGGGGAAGGGGAGGAGAGG + Intergenic
996560389 5:124822004-124822026 GAAAAGGTGGAGGGGAGGAGAGG + Intergenic
997105451 5:131013737-131013759 GAATCGTGGTGGGGGAGGAGTGG + Intergenic
997225766 5:132208416-132208438 GGAGGGGGGGAGGGGAGGAGAGG + Intronic
997420850 5:133765634-133765656 GAATGGCAGGAAGGGAGGAGAGG + Intergenic
999514916 5:152291429-152291451 GAATAGGGGGGCCTGAGGAGAGG - Intergenic
999736037 5:154513979-154514001 GAGTGGGGGGCTGGGAGGAGTGG - Intergenic
999796460 5:154993796-154993818 GAAGGGAGGGAGGGGAGGAGAGG - Intergenic
1000589786 5:163144485-163144507 GAAACGTGGGTAGGGAGGAGGGG - Intergenic
1001036471 5:168300288-168300310 TAATGGGGTGGCGGGAGGAGGGG + Intronic
1001245798 5:170105193-170105215 GAATGAGGGGATGGGAAGAGAGG + Intergenic
1001706032 5:173741731-173741753 GGATAGGGGGACAGGGGGAGAGG + Intergenic
1001748102 5:174107522-174107544 GAATGGGGGGCGGGGTGGAGAGG + Exonic
1002042297 5:176523509-176523531 GAAGAGGAGGAGGGGAGGAGGGG - Intergenic
1002927404 6:1612457-1612479 GAGAGGGGAGACGGGAGGAGGGG - Exonic
1003395466 6:5749130-5749152 GTATGAGGGGACGGGAGGAGAGG - Intronic
1003575795 6:7293343-7293365 GACTCGGGGAAGGGTAGGAGGGG - Intronic
1003619990 6:7691333-7691355 GAAGGAGGGGAAGGGAGGAGAGG - Intergenic
1004911097 6:20285030-20285052 GACTCTGGGGACTGCAGGAGCGG + Intergenic
1005300374 6:24464782-24464804 GAATCGGGGAAAGGGCAGAGCGG - Intronic
1006372280 6:33652542-33652564 GAACCGGGGGTCGGGGGCAGAGG - Intronic
1007095612 6:39210966-39210988 GAGTAGGGGAAGGGGAGGAGGGG - Intronic
1007341573 6:41194198-41194220 GGGTCGGGGGTGGGGAGGAGGGG - Intronic
1007691534 6:43704838-43704860 GAATCTGGTGAGGGGAGAAGGGG - Intergenic
1009026003 6:58001144-58001166 GAATGGGGAGTCAGGAGGAGAGG - Intergenic
1009201558 6:60752612-60752634 GAATGGGGAGTCAGGAGGAGAGG - Intergenic
1009593716 6:65708714-65708736 GAATGGGGGGAGTGGAGAAGGGG - Intergenic
1012287678 6:97412811-97412833 GAATAGGGGGACTCAAGGAGAGG + Intergenic
1013052305 6:106548285-106548307 GAATGGGGGGAGTGGGGGAGGGG - Intronic
1013164578 6:107578236-107578258 GAATGGGGGGAAGGGAGGGAGGG - Intronic
1014421039 6:121245731-121245753 GAATCTGGGGATGGGGGGAGGGG - Intronic
1015113381 6:129619326-129619348 GAAAAGGGGGAGGGGAGGACAGG + Intronic
1015208894 6:130672876-130672898 GGATGAGGGGGCGGGAGGAGAGG - Intergenic
1015976271 6:138794535-138794557 TAATTGGGGGAGGGGAGGAGAGG + Intergenic
1016461909 6:144286467-144286489 GACTGAGGGGACAGGAGGAGGGG + Intronic
1017993103 6:159506935-159506957 GAATCCAGGGCCGGGAGCAGTGG + Intergenic
1018149747 6:160926596-160926618 GAATCTGGGTGCGGGAGGAGAGG + Intergenic
1018798879 6:167207605-167207627 GAGTTGGGGGAGGGTAGGAGAGG + Intergenic
1018981011 6:168601828-168601850 GCATCGATGGACGGGAAGAGAGG - Intronic
1019532700 7:1511598-1511620 GAATCGGGAGCCGTGAGGAAGGG + Intergenic
1019954486 7:4402479-4402501 GAATCATGGGACCGGAGGAGTGG + Intergenic
1020133173 7:5570774-5570796 GTATCAGGGGTGGGGAGGAGTGG - Intergenic
1021267971 7:18548137-18548159 GAATAGGGAGACCTGAGGAGAGG + Intronic
1022262982 7:28724693-28724715 GAATATGGGGACAGGAAGAGTGG - Intronic
1022282761 7:28927553-28927575 CAACCGGGGGCCGGGAGGGGAGG + Intergenic
1022302635 7:29115456-29115478 GAAGAGTGGGAGGGGAGGAGTGG - Intronic
1023003756 7:35840211-35840233 GAAAGGGGGGAAGGGGGGAGGGG - Intronic
1023800342 7:43828411-43828433 CAATCGGGGGGGGGGAGGGGGGG - Intergenic
1023828263 7:44024280-44024302 GGATCTGGGGAGGGGAGGAGAGG + Intergenic
1024619649 7:51146646-51146668 GAATGTGGGGGCGGGGGGAGGGG + Intronic
1026494056 7:70887793-70887815 GAAGTGGGGGAAGGGAGGAAAGG + Intergenic
1028567194 7:92246205-92246227 CACTCGGGGGAGGGGAAGAGGGG - Intergenic
1028768597 7:94589270-94589292 GAATGTGGGGACTGAAGGAGAGG - Intronic
1029042210 7:97588340-97588362 GAATCAGGGAAAGGGATGAGGGG - Intergenic
1029110402 7:98210957-98210979 CTGTCGGGGGACGGGAGTAGGGG + Intergenic
1029412887 7:100426955-100426977 GGAAAGGGGGAAGGGAGGAGGGG - Intronic
1029456527 7:100674909-100674931 AAATCGGGGGATGGGGGGTGCGG - Intronic
1029722423 7:102377847-102377869 GAAGCGAGGGAGGGGAGGGGAGG - Intronic
1029756564 7:102577726-102577748 GGATCTGGGGAGGGGAGGAGAGG + Intronic
1029774506 7:102676795-102676817 GGATCTGGGGAGGGGAGGAGAGG + Intergenic
1033354463 7:140588364-140588386 GAAAAGGGGGCCGGGAGCAGTGG + Intronic
1033476946 7:141701429-141701451 GGAGCGGGGGACGGGATGGGGGG + Intronic
1033533402 7:142288899-142288921 AAATGGGGGGTCAGGAGGAGTGG - Intergenic
1033969777 7:147025334-147025356 GAAAGGGGGGAGGGGAGGGGAGG + Intronic
1033969839 7:147025449-147025471 GAGGAGGGGGAGGGGAGGAGGGG + Intronic
1034028169 7:147730598-147730620 GAATAGGGGGTCTTGAGGAGAGG - Intronic
1034412458 7:150948419-150948441 GAGGCGGGGGAGGGGAGGAAGGG - Intronic
1034422335 7:150996327-150996349 GAGTTGGGGGCAGGGAGGAGGGG - Intronic
1034889732 7:154829402-154829424 GAAGAGGGGGAGAGGAGGAGAGG + Intronic
1035371962 7:158385870-158385892 GACTCGGGGCATGGGAGGAGGGG - Intronic
1035387084 7:158480406-158480428 GAATAGGGAGGCTGGAGGAGAGG - Intronic
1035596070 8:858951-858973 GAAACTGGGGTGGGGAGGAGGGG + Intergenic
1036792615 8:11731577-11731599 GGATCGGGGTGCGGGAGGATGGG + Intronic
1036905856 8:12707941-12707963 GAGCCGGGGGAGGGGAGTAGAGG + Intergenic
1038043181 8:23744047-23744069 GAGTTGGGGGAAGAGAGGAGAGG - Intergenic
1038360099 8:26866786-26866808 GAATCGGGGGTGGGGTAGAGGGG + Intronic
1038447900 8:27616463-27616485 GAATTAGGGGAAGGGAAGAGAGG + Intergenic
1040436190 8:47393903-47393925 GAAGCAGGGGATGGGAGGGGAGG - Intronic
1040509864 8:48084323-48084345 GAATCTGGGGATGGTTGGAGAGG + Intergenic
1040600611 8:48880195-48880217 GAGTCGCGTGACTGGAGGAGGGG + Intergenic
1041586433 8:59525591-59525613 GAATAGGGAGACCTGAGGAGAGG - Intergenic
1041837828 8:62236513-62236535 GACTCGGGGGAATGGATGAGGGG - Intergenic
1042333030 8:67602329-67602351 GAATTGGGTGACTGGAGAAGAGG + Intronic
1042952423 8:74214976-74214998 CAATGGGGGGAGGGGAGGAAGGG - Intergenic
1043238530 8:77900099-77900121 GAAAAGGGGGAAGGGAGGAAGGG - Intergenic
1043485546 8:80695490-80695512 GAATCAGGGGAGGGGGCGAGGGG - Intronic
1043908348 8:85833118-85833140 GAGACGGGAGATGGGAGGAGGGG - Intergenic
1045461289 8:102427833-102427855 GAATGGGGGGGTGGGGGGAGGGG - Intergenic
1045509898 8:102806335-102806357 GAACCCGAGGGCGGGAGGAGGGG - Intergenic
1049388136 8:142354598-142354620 GAAGTGGGGGCGGGGAGGAGGGG - Intronic
1049547977 8:143243390-143243412 GATGAGGGGGAGGGGAGGAGGGG + Intergenic
1049610534 8:143552934-143552956 GAGTGGGGGGAGGGGAGGGGAGG + Intergenic
1050494916 9:6230547-6230569 GAAGCGGGGGATGGGAGCACAGG - Intronic
1050744322 9:8858391-8858413 GAGTCGAGGGCCGGGAGGTGGGG + Intronic
1051351016 9:16197934-16197956 GATTCGGGGGGCAGGAGGTGGGG - Intergenic
1051387217 9:16522153-16522175 GAAAAGGGGGGCAGGAGGAGAGG + Intronic
1051642741 9:19238574-19238596 GAGGAGGGGGAGGGGAGGAGAGG - Intronic
1051642761 9:19238612-19238634 GAGAGGGGGGAGGGGAGGAGAGG - Intronic
1052877877 9:33580970-33580992 GATTTGGGGGACTGTAGGAGAGG + Intergenic
1053348508 9:37395658-37395680 GAACCGGTGGGCTGGAGGAGGGG + Intergenic
1053495045 9:38543626-38543648 GAATCGTGGGAGGGGAGGCCTGG - Intronic
1053498102 9:38563235-38563257 GATTTGGGGGACTGTAGGAGAGG - Intronic
1056544935 9:87605806-87605828 GAAGCTGGGGACTGGAGGGGTGG - Intronic
1057781911 9:98056967-98056989 GATTCGGGCGCCGGGAGGGGCGG + Intronic
1057903023 9:98964197-98964219 GAATGGGGGGGTGGGAGGGGAGG - Intronic
1059417967 9:114173695-114173717 GATGCGGGGGTCGGGGGGAGGGG + Intronic
1060276479 9:122186676-122186698 GAGTCGGGGGGCGGCAGGGGAGG - Intronic
1061072078 9:128317027-128317049 GAATCAGGGCAGGAGAGGAGTGG + Intronic
1061425456 9:130495576-130495598 GAATGGGGGGAGGGGTGGAAGGG + Intronic
1062212519 9:135372599-135372621 CAAGCGCCGGACGGGAGGAGCGG - Intergenic
1062230583 9:135479774-135479796 GAAGCGCGGGAGGGGAGGGGCGG - Intronic
1062314022 9:135956674-135956696 GAATCGTGGGGTGAGAGGAGAGG + Intronic
1062377222 9:136267662-136267684 GCATAGGGGGATGGGAGGGGCGG - Intergenic
1203546643 Un_KI270743v1:133237-133259 GAATCGGGGGTGGGGAGGGTTGG - Intergenic
1185511597 X:668165-668187 GGAGGAGGGGACGGGAGGAGGGG - Intergenic
1185511664 X:668311-668333 GAAGTGGGGGAGGGGAGGGGAGG - Intergenic
1185726179 X:2423728-2423750 GAGTGGGGGGCGGGGAGGAGGGG - Intronic
1186443246 X:9604122-9604144 GAATTGGGAGAAGGGTGGAGTGG - Intronic
1187693591 X:21896360-21896382 GGCTGGGGGGAAGGGAGGAGTGG - Intergenic
1188187138 X:27129610-27129632 GAATTAGGGTAAGGGAGGAGAGG - Intergenic
1188236789 X:27741335-27741357 GGCTCTGGGGAGGGGAGGAGAGG - Intronic
1188483055 X:30653659-30653681 GAGTCGGGGGACGGAGGGGGTGG + Intronic
1188591758 X:31845426-31845448 AAAGAGAGGGACGGGAGGAGAGG - Intronic
1189487981 X:41447373-41447395 GGGTGGGGGGACGGGAGGAAGGG - Intergenic
1189750167 X:44212547-44212569 GAGTAGGGGGAGGGGAGGGGAGG + Intronic
1190259675 X:48790026-48790048 GAAGTGGAGGAGGGGAGGAGAGG + Intronic
1190712710 X:53081656-53081678 GAAGCGGGGGATGGGGGAAGGGG + Intergenic
1192610559 X:72562519-72562541 GACTCGGGGGAAAGGATGAGGGG + Intronic
1193181654 X:78465564-78465586 GACTCGGGGGATGGGTGAAGGGG - Intergenic
1196714378 X:118797527-118797549 GAATCAGGGGTAAGGAGGAGTGG - Intergenic
1197143651 X:123145798-123145820 GGATTGGGGGAAGGGAGGAATGG - Intergenic
1197642258 X:128979934-128979956 GACTCGGGGCAGGGGAGGATGGG + Intergenic
1198215320 X:134549754-134549776 GGAAGGGGGGAGGGGAGGAGAGG + Intergenic
1198968953 X:142258494-142258516 GAATCTGGGGAAGTGAGAAGAGG - Intergenic
1199765995 X:150941997-150942019 GAAGAGGGGGAAGGAAGGAGGGG + Intergenic