ID: 1104894465

View in Genome Browser
Species Human (GRCh38)
Location 12:132155032-132155054
Sequence ACCCGGAATCGGGGGACGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894465_1104894474 0 Left 1104894465 12:132155032-132155054 CCTCCCGTCCCCCGATTCCGGGT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109
1104894465_1104894477 7 Left 1104894465 12:132155032-132155054 CCTCCCGTCCCCCGATTCCGGGT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894465 Original CRISPR ACCCGGAATCGGGGGACGGG AGG (reversed) Intergenic
900700943 1:4048318-4048340 ACCCGGCATCTGGGGAGAGGAGG + Intergenic
902623486 1:17663846-17663868 ACCCGGAATCGGGAGACTTGGGG - Intronic
905037675 1:34928621-34928643 ACCAGGAATGGGGGGACAGTGGG + Intronic
914871501 1:151478825-151478847 ACCTGGGATGGGGGGGCGGGGGG - Intergenic
915572506 1:156752006-156752028 CCGCGGAGTCGGGGGAAGGGCGG - Intronic
918265689 1:182839594-182839616 ACCCGCAATCCGGGGACCCGCGG - Intronic
1067557064 10:47279780-47279802 CCACGGAATGGGTGGACGGGTGG - Intergenic
1070768533 10:79069627-79069649 ACCGGGAATCGGAGGAGGGAGGG + Intronic
1072807004 10:98429987-98430009 ACCCGGAACGGGTGGAGGGGTGG - Intronic
1077239070 11:1501212-1501234 ACCCGGAACAGGGGGACAGCAGG + Intronic
1096503923 12:52081258-52081280 CTCCAGAATCGGGGGAGGGGGGG - Intergenic
1096520638 12:52182728-52182750 ACCAGGAGTCAGGGGACTGGAGG + Intronic
1101706511 12:107225707-107225729 TCCCGGGATGGGGGGATGGGTGG - Intergenic
1102521628 12:113480742-113480764 AGCTGGAAGCGGGGGGCGGGGGG + Intergenic
1102676916 12:114665418-114665440 CTCTGGAATCGGGGGGCGGGGGG - Intergenic
1103568922 12:121831174-121831196 ACCCGTAATGGCGGGACTGGGGG - Exonic
1104894465 12:132155032-132155054 ACCCGGAATCGGGGGACGGGAGG - Intergenic
1105019970 12:132809438-132809460 ACCGGGAACCGGGGGGCGGGGGG - Intronic
1108269941 13:48749618-48749640 ACCTGGCATCGGGGGAGGAGAGG - Intergenic
1110226079 13:73121108-73121130 ACCCGGGGTTGGGGGGCGGGGGG + Intergenic
1113862718 13:113500172-113500194 ACCAGGAATTGGGGGAAGGCAGG - Intronic
1117812728 14:59565810-59565832 ACCTGGCATCTGGGGACGGGTGG - Intronic
1118220711 14:63852925-63852947 ACCCGGAGGCGGGCGGCGGGCGG + Intergenic
1122771631 14:104100270-104100292 ACCAGAAGTCGGGGGACAGGAGG + Intronic
1127112075 15:55685091-55685113 AACTGGAATCTGGGGAGGGGAGG - Intronic
1128865978 15:71115531-71115553 ACGCGGAATCGGGGCACAGCGGG + Intronic
1129464006 15:75713606-75713628 ACCCGGATTCAGGGGTCAGGAGG - Intergenic
1132163619 15:99565289-99565311 GCCCGGAGTCCGGGGCCGGGCGG - Intergenic
1132309957 15:100849980-100850002 ACCCGGGAGCGGGGGGCGGGGGG + Intergenic
1133793843 16:9030483-9030505 ACCCGGAATGGGGGGCGGGGGGG - Intergenic
1134584124 16:15396240-15396262 ACCCAGTATTGGGGGACTGGAGG + Intronic
1136389244 16:29951931-29951953 GCCTGGAATCGGGGGAAGGGTGG + Intronic
1144109954 17:12021330-12021352 TCCCGGAAACGGGGGCCGGGCGG - Intronic
1144764118 17:17723706-17723728 CCCCAGACTCGGGGGAAGGGAGG - Intronic
1146623070 17:34415293-34415315 ACCCGGACTTGAGGGACGGCTGG + Intergenic
1151487962 17:74413708-74413730 ACCCGGAATGAGGGGCTGGGTGG + Intergenic
1152087976 17:78231933-78231955 GCCGGGAGCCGGGGGACGGGGGG - Exonic
1152248312 17:79197908-79197930 GCCCGGAGTCGGGGGAGGTGAGG - Intronic
1160629785 18:80238847-80238869 TCACAGAATCGGGGGGCGGGCGG + Intronic
1163729317 19:18940435-18940457 ACCCGAGTGCGGGGGACGGGGGG + Intronic
1166688316 19:44808994-44809016 CCCGGGCATCGGGGGACGAGGGG + Intergenic
1168686261 19:58351250-58351272 ACCCTGAATCGGCGGGTGGGCGG + Intronic
926310175 2:11669469-11669491 AGCGGGAGTCGGGGGAGGGGGGG - Intronic
932404336 2:71503598-71503620 ACCAGGAAGCTGGGGACAGGAGG - Intronic
933870737 2:86563181-86563203 CCCCGGAAATGGGGGCCGGGCGG + Intronic
937042889 2:118835251-118835273 ACCAGGAAGAGGGGGAGGGGTGG - Intergenic
937083521 2:119156790-119156812 ACCCGGATTAGGGGCGCGGGGGG - Exonic
944854973 2:203759078-203759100 TCCTGGAATTGGGGGAGGGGTGG + Intergenic
946248480 2:218400004-218400026 GGCCGGAATCGGGGCGCGGGGGG - Exonic
948568945 2:238905278-238905300 CCCAGGAGTCGGGGGATGGGTGG - Intronic
948892708 2:240915166-240915188 CCCTGGAATGGGGGGCCGGGAGG - Intergenic
1172481931 20:35276584-35276606 ACCAGGAAGTGGGGGAAGGGAGG - Exonic
1172807877 20:37625839-37625861 AGCAGGAATCGGGGGTGGGGAGG + Intergenic
1172951163 20:38724286-38724308 ACCCGGAGGCAGGGGACGTGAGG - Intergenic
1176034865 20:63031347-63031369 ACCCTGAGTCGGGGGAGAGGGGG + Intergenic
1179841140 21:44074704-44074726 ACCCTGAGTCGGGGGACACGAGG + Intronic
1180018144 21:45100933-45100955 ACCCGGGATTGGGGTAGGGGTGG + Intronic
1181903077 22:26170904-26170926 ACTCGGAGTTGGGGGACAGGCGG + Intronic
1184094868 22:42311092-42311114 TGCAGGAATCGGGGGACAGGGGG + Intronic
968235676 3:197029126-197029148 GCCCGGGATGGTGGGACGGGAGG - Intronic
968479202 4:826284-826306 ACCCGGGGGCGGGGGGCGGGGGG + Intergenic
969357890 4:6641337-6641359 CACCGGAATCGGGGGTGGGGCGG + Intronic
971679638 4:29680070-29680092 ACCTGGACTGGGGGGATGGGTGG + Intergenic
980660875 4:135855934-135855956 GCCTGGAATCAGGGGAGGGGTGG + Intergenic
992378506 5:76213869-76213891 ACCAGGAATTGAGGGATGGGGGG - Intronic
999124590 5:149237880-149237902 ACAGGGAGTCGGGGGACTGGGGG - Intronic
1003092998 6:3119492-3119514 ACCTGAAATGGGGGGACAGGTGG - Intronic
1007750568 6:44068370-44068392 ACCCAGAAGCGGGGGACAGCAGG - Intergenic
1020892533 7:13897143-13897165 ACCCGGGGTGGGGGGATGGGTGG + Intronic
1026440073 7:70436631-70436653 ATCCAGAAACGGGGGAAGGGAGG - Intronic
1027685402 7:81274115-81274137 GCCTGGAGTCGGGGGAGGGGTGG + Intergenic
1028929613 7:96398082-96398104 ACCTGGGATCGGGGGAGGGGTGG + Intergenic
1032214703 7:129948980-129949002 ACCCGGAAAAGGAGGAGGGGAGG - Intronic
1041107977 8:54459583-54459605 GCCCGGAATCGAGGGACCCGCGG - Exonic
1042399605 8:68330888-68330910 AGCAGGAATCAGGGGGCGGGAGG - Exonic
1049784496 8:144444108-144444130 GGCCGGGATCGGGGGCCGGGGGG - Intronic
1053586507 9:39464365-39464387 CCCAGGAACCTGGGGACGGGCGG - Intergenic
1054579799 9:66900868-66900890 CCCAGGAACCTGGGGACGGGCGG + Intronic
1059346776 9:113634417-113634439 ACCCTGACTCAGGGGACAGGGGG + Intergenic
1061347851 9:130042053-130042075 CCCAGGAATCCGGGGACGGCAGG + Intronic
1203486942 Un_GL000224v1:64967-64989 ACCCCGAATGGAGGGACTGGCGG - Intergenic
1203499562 Un_KI270741v1:6867-6889 ACCCCGAATGGAGGGACTGGCGG - Intergenic
1188907455 X:35805534-35805556 ACCCTAAGTCGGGGGAAGGGAGG - Intergenic
1195172376 X:102281731-102281753 ACCAGGGGTCGGGGGAGGGGGGG - Intergenic
1195186488 X:102405363-102405385 ACCAGGGGTCGGGGGAGGGGGGG + Intronic
1200827830 Y:7661341-7661363 ACCAGGAATCAGGGGACTGCTGG - Intergenic