ID: 1104894466

View in Genome Browser
Species Human (GRCh38)
Location 12:132155035-132155057
Sequence GAGACCCGGAATCGGGGGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 249}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894466_1104894477 4 Left 1104894466 12:132155035-132155057 CCCGTCCCCCGATTCCGGGTCTC 0: 1
1: 0
2: 1
3: 9
4: 249
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894466_1104894474 -3 Left 1104894466 12:132155035-132155057 CCCGTCCCCCGATTCCGGGTCTC 0: 1
1: 0
2: 1
3: 9
4: 249
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894466 Original CRISPR GAGACCCGGAATCGGGGGAC GGG (reversed) Intergenic
903228779 1:21909450-21909472 GAGACATGGAATCTAGGGACTGG - Intronic
904600663 1:31670979-31671001 GAGCCCCCCACTCGGGGGACAGG - Intronic
905295429 1:36951587-36951609 GAGGCCCTGCATTGGGGGACTGG + Intronic
907442520 1:54488017-54488039 GAGACCGGGAAGCAGGGGTCAGG + Intergenic
907787368 1:57625773-57625795 AAGACCGGGAATCAGGGGAGTGG + Intronic
908019669 1:59886778-59886800 GGGACCCCGAATGGAGGGACCGG + Intergenic
910453591 1:87372201-87372223 GAGACCAGGAAGAGAGGGACTGG - Intergenic
912441530 1:109702630-109702652 GGGACCCCGAATGGAGGGACCGG + Intronic
914214988 1:145617678-145617700 GGGACCCCGAATGGAGGGACTGG - Intronic
914466935 1:147938072-147938094 GGGACCCCGAATGGAGGGACTGG - Intronic
917129261 1:171723949-171723971 GCGACCCCGAATGGAGGGACTGG - Intronic
918087009 1:181254243-181254265 GGGACCCCGAATGGAGGGACCGG + Intergenic
918848095 1:189644942-189644964 GGGACCCTGAATGGAGGGACCGG - Intergenic
919190056 1:194204546-194204568 GGGACCCCGAATGGAGGGACCGG - Intergenic
920260303 1:204684454-204684476 GAGACCCGGAACCTGGGGAGGGG - Intronic
921900399 1:220444108-220444130 GGGACCCCGAATGGAGGGACTGG + Intergenic
924120122 1:240789026-240789048 GGGACCCTGAATGGAGGGACCGG + Intronic
924296864 1:242596562-242596584 GGGACCCCGAATGGAGGGACCGG + Intergenic
1065497843 10:26348446-26348468 GGGACCCTGAATGGAGGGACCGG + Intergenic
1065512546 10:26493539-26493561 GGGACCCCGAATGGAGGGACCGG - Intronic
1065936147 10:30522152-30522174 GGGACCCCGAATGGAGGGACCGG + Intergenic
1066626639 10:37413635-37413657 GGGACCCCGAATGGAGGGACTGG - Intergenic
1067075916 10:43182097-43182119 GGGACCCCGAATGGAGGGACTGG - Intronic
1068071688 10:52204448-52204470 GGGACCCCGAATGGAGGGACTGG + Intronic
1068537431 10:58255774-58255796 GAGACCCCGAACGGAGGGACCGG + Intronic
1069162351 10:65107459-65107481 GGGACCCCGAATGGAGGGACCGG - Intergenic
1069288056 10:66741659-66741681 GGGACCCCGAATGGAGGGACTGG + Intronic
1069737648 10:70667742-70667764 GGAACCCGGAATGGAGGGACCGG + Intergenic
1069842277 10:71347313-71347335 GAGTCAGGGAGTCGGGGGACCGG + Intronic
1073353986 10:102839206-102839228 GGGACCCTGAATGGAGGGACTGG - Intergenic
1074211811 10:111342167-111342189 GGGACCCCGAATGGAGGGACTGG - Intergenic
1074544697 10:114393567-114393589 GAGACCTGGAGGCTGGGGACAGG + Intronic
1074820610 10:117175444-117175466 GAGACCCGTAGGCCGGGGACAGG + Intergenic
1076633648 10:131868592-131868614 GAACCCCGGAATCTGGGGAGGGG - Intergenic
1076731700 10:132442539-132442561 GGGGGCCGGAATGGGGGGACCGG + Intergenic
1079975899 11:27091174-27091196 GGGACCCTGAATGGAGGGACTGG - Intronic
1080994901 11:37587747-37587769 GGGACCCCGAATGGAGGGACCGG + Intergenic
1081236191 11:40649853-40649875 GGGACCCTGAATGGAGGGACTGG - Intronic
1081328473 11:41775011-41775033 GGGACCCCGAATGGAGGGACTGG - Intergenic
1084383392 11:68827711-68827733 GAGCCCCGCATTCTGGGGACAGG - Intronic
1085947100 11:81284962-81284984 GGGACCCTGAATGGAGGGACCGG + Intergenic
1087045539 11:93841084-93841106 GAGACCTGGAAGAGGGGGAGAGG - Intronic
1091410410 12:235389-235411 GGGACCCCGAATGGAGGGACTGG + Intronic
1093348014 12:18063593-18063615 GGGACCCTGAATGGAGGGACTGG - Intergenic
1096520637 12:52182725-52182747 GACACCAGGAGTCAGGGGACTGG + Intronic
1097270735 12:57772448-57772470 GAGACCAGGAGTAAGGGGACAGG - Exonic
1097515817 12:60604334-60604356 GGGACCCTGAATGGAGGGACTGG - Intergenic
1098160933 12:67648273-67648295 GGGACCAAGAATGGGGGGACGGG + Intergenic
1098741218 12:74175798-74175820 GGGACCCTGAATGGAGGGACCGG - Intergenic
1103017243 12:117504912-117504934 GAGACTCGGAATGGGGAGAATGG - Intronic
1104069690 12:125333591-125333613 GAGAGCTGGAATGGGGCGACAGG + Intronic
1104277969 12:127347449-127347471 GGGACCCCGAATGGAGGGACTGG - Intergenic
1104693114 12:130841194-130841216 GGGACCCTGAATGGAGGGACCGG + Intergenic
1104820252 12:131672919-131672941 GAGACCCAGGATCTGGGGGCTGG - Intergenic
1104894466 12:132155035-132155057 GAGACCCGGAATCGGGGGACGGG - Intergenic
1105019973 12:132809441-132809463 CAGACCGGGAACCGGGGGGCGGG - Intronic
1107520554 13:41176340-41176362 GGGACCCCGAATGGAGGGACAGG - Intergenic
1109590530 13:64475297-64475319 GGGACCCTGAATGGAGGGACTGG + Intergenic
1109682500 13:65771421-65771443 GGGACCCCGAATGGAGGGACTGG + Intergenic
1109963311 13:69659879-69659901 GAGACCCCAAATGGAGGGACTGG + Intergenic
1110579919 13:77109721-77109743 GAGATCCTGAATGGAGGGACTGG + Intronic
1113213999 13:108017007-108017029 GGGACCCCGAATGGAGGGACCGG + Intergenic
1113651017 13:112034281-112034303 GAGAGCCTGAAGCGGGGGAGAGG - Intergenic
1113769480 13:112898977-112898999 CAGACCCGGCATGGGGGGAGGGG - Intronic
1113779628 13:112968813-112968835 GAGACCCGGAACCGGGGGGAAGG + Intronic
1116301851 14:43193058-43193080 GAGACCCCGAACGGAGGGACTGG - Intergenic
1116725863 14:48561018-48561040 GGGACCCTGAATGGAGGGACTGG + Intergenic
1121099499 14:91240785-91240807 GGGACCCTGAATGGAGGGACCGG - Intronic
1122217654 14:100214578-100214600 GAGAGCCGGAAGCGCGGGGCGGG - Intergenic
1122844314 14:104482867-104482889 GGGACCCTGAATGGAGGGACTGG - Intronic
1202889841 14_KI270722v1_random:145740-145762 GAGATCCAGAATGGAGGGACTGG - Intergenic
1123849113 15:24335724-24335746 GAGACCCGGAACCGAGGGACTGG - Intergenic
1123868172 15:24543236-24543258 GGGACCCCGAACCGAGGGACCGG - Intergenic
1125005109 15:34808051-34808073 GGGACCCCGAATGGAGGGACCGG - Intergenic
1127092310 15:55479262-55479284 GGGACCCCGAATGGAGGGACTGG + Intronic
1128598860 15:68978160-68978182 GGGACCCTGAATGGAGGGACTGG - Intronic
1132309954 15:100849977-100849999 GGGACCCGGGAGCGGGGGGCGGG + Intergenic
1134584123 16:15396237-15396259 GGGACCCAGTATTGGGGGACTGG + Intronic
1139014073 16:62668829-62668851 GGGACCCCGAATGGAGGGACCGG + Intergenic
1142400945 16:89858535-89858557 GAGACCAGGAATGGGAGGATGGG + Intronic
1144775592 17:17783183-17783205 GCGACCGGGGACCGGGGGACCGG + Intronic
1145292370 17:21558557-21558579 GGGACCCCGAATGGAGGGACTGG + Intronic
1145387589 17:22427349-22427371 GGGACCCTGAATGGAGGGACTGG - Intergenic
1146166885 17:30596694-30596716 GGGACCCCAAATGGGGGGACTGG - Intergenic
1146206041 17:30906399-30906421 GGGACTCGGGATCCGGGGACAGG - Exonic
1146282733 17:31555647-31555669 GAGCCCCAGAATCAGGGGAAAGG - Intergenic
1147840262 17:43366642-43366664 GGGACCCTGAATGGAGGGACCGG - Intergenic
1148835341 17:50463057-50463079 GGGACCGGGAATCAGGAGACAGG - Intronic
1150187863 17:63204787-63204809 GAGACCAGAAATAGGGGGCCAGG + Intronic
1150634562 17:66903923-66903945 GACACCAGGAATCGGCGGGCGGG - Intergenic
1151864750 17:76793808-76793830 GGGACCCCGAATGGAGGGACCGG - Intergenic
1151959975 17:77400697-77400719 GAGACCCGGACTCTGTGGCCTGG + Intronic
1153485571 18:5594266-5594288 GGGACCCCGAATGGAGGGACCGG - Intronic
1153722138 18:7916087-7916109 GAGACCCTGAAAGGTGGGACGGG + Intronic
1157494477 18:48145433-48145455 GAGACCCGCAATCAGGGCAGGGG - Intronic
1157643714 18:49244937-49244959 GGGACCCGGAACAGAGGGACTGG + Intronic
1157706248 18:49809442-49809464 GGGACCCTGAATGGAGGGACCGG - Intronic
1157758687 18:50242511-50242533 GGGACCCTGAATGGAGGGACCGG - Intronic
1159074501 18:63665296-63665318 GGGACCCTGAACCGAGGGACTGG + Intronic
1160580136 18:79879041-79879063 GAGACCCGGATGTGGGGGTCAGG + Intronic
1160620239 18:80165657-80165679 GGGACCCTGAATGGAGGGACTGG - Intronic
1162684234 19:12368475-12368497 GGGACCCCGAATGGAGGGACCGG - Intergenic
1163959653 19:20677073-20677095 GGGACCCCGAATGGAGGGACTGG + Intronic
1164330582 19:24250783-24250805 GGGACCCTGAATGGAGGGACTGG + Intergenic
1165288738 19:34866310-34866332 GGGACCCCGAATGGAGGGACTGG - Intergenic
1167040408 19:47020160-47020182 GAGACCTGGACACGGGGGTCTGG + Intronic
1167266459 19:48485374-48485396 GAGACGCGAAATGGGGGGTCCGG + Exonic
1167320562 19:48795153-48795175 GAGATCCGGAATCGGGGCCAAGG + Exonic
1167647906 19:50715765-50715787 GAGACTTGGAATCAGGGGCCTGG + Intronic
925164333 2:1706104-1706126 GAGCCCAGGAATCGGAGGGCAGG - Intronic
925393393 2:3514840-3514862 GGGACCCCGAATGGAGGGACCGG + Intronic
925660562 2:6197964-6197986 GGGACCCCGAATGGAGGGACTGG + Intergenic
925974776 2:9134411-9134433 GGGACCCCGAATGGAGGGACCGG - Intergenic
926130934 2:10302837-10302859 GGGACCCGGAGGCGGGGGCCGGG - Intergenic
926310178 2:11669472-11669494 GAGAGCGGGAGTCGGGGGAGGGG - Intronic
926859175 2:17290951-17290973 GGGACCCCGAATGGAGGGACTGG - Intergenic
929254128 2:39791157-39791179 GGGACCCCGAATGGAGGGACCGG - Intergenic
929350158 2:40941266-40941288 GGGACCCCGAATGGAGGGACTGG + Intergenic
931599364 2:63988460-63988482 GGGACCCCGAACCGAGGGACTGG + Intronic
935142526 2:100365934-100365956 GGGACCCCGAATGGAGGGACCGG - Intergenic
936686832 2:114837323-114837345 GGGACCCGGAACGGAGGGACCGG - Intronic
937613264 2:123889788-123889810 GGGACCCTGAATGGAGGGACCGG + Intergenic
937838413 2:126497818-126497840 GGGACCCCGAATGGAGGGACAGG - Intergenic
938308794 2:130271749-130271771 GGGACCCCGAATGGAGGGACCGG - Intergenic
938480226 2:131657138-131657160 TAGTCCAGGAAGCGGGGGACTGG + Intergenic
938842669 2:135178120-135178142 GGGACCCTGAATGGAGGGACCGG - Intronic
939822146 2:146970455-146970477 GGGACCCCGAATGGAGGGACTGG - Intergenic
942108635 2:172658230-172658252 GGGACCCCGAATGGAGGGACTGG + Intergenic
942312809 2:174671121-174671143 GGGACCCCGAATGGAGGGACCGG + Intronic
943872938 2:193025215-193025237 GGGACCCTGAATGGAGGGACGGG + Intergenic
944174864 2:196818163-196818185 GGGACCCCGAATGGAGGGACTGG - Intergenic
945897152 2:215496739-215496761 GGGACCCCGAATGGAGGGACCGG + Intergenic
946167865 2:217876324-217876346 GGGACCTGGAATCTGGGCACGGG + Intronic
1168892753 20:1305588-1305610 CAGACCCTGAGTCAGGGGACAGG + Exonic
1176034862 20:63031344-63031366 GTGACCCTGAGTCGGGGGAGAGG + Intergenic
1177213217 21:18095983-18096005 GGGACCCTGAATGGAGGGACTGG + Intronic
1177238982 21:18431395-18431417 GAGACCCAGAATCAAGGGATAGG - Intronic
1180118911 21:45732970-45732992 GAGACCCAGAAGCAGGGGATGGG - Intronic
1180331966 22:11489482-11489504 GAGATCCCGAATGGAGGGACTGG - Intergenic
1184094865 22:42311089-42311111 GAGTGCAGGAATCGGGGGACAGG + Intronic
1184294372 22:43514701-43514723 GAGTCAGGGAATCGGGGGGCGGG - Intergenic
1185076145 22:48683877-48683899 GAGAGCCGGCAACGGGGGAGGGG - Intronic
1185333045 22:50260208-50260230 GTGGCCAGGAACCGGGGGACGGG + Intronic
951240636 3:20282494-20282516 GGGACCCTGAATGGAGGGACCGG + Intergenic
952288853 3:31995769-31995791 GGGACCCTGAATGGAGGGACCGG - Intronic
953119552 3:40026615-40026637 GGGACCCTGAATGGAGGGACTGG - Intronic
955924516 3:63992348-63992370 TAGACACAGAATCAGGGGACTGG + Intronic
957090673 3:75727017-75727039 GAGACCCCAAATGGAGGGACTGG + Intronic
958417258 3:93889627-93889649 GGGACCCCGAATGGAGGGACTGG + Intronic
958424331 3:93963928-93963950 GGGACCCTGAATGGAGGGACCGG + Intronic
958625331 3:96615504-96615526 GGGACCCCGAACAGGGGGACAGG - Intergenic
958756473 3:98255283-98255305 GGGACCCTGAATGGAGGGACTGG - Intergenic
959939045 3:112060984-112061006 GGGACCCTGAATGGAGGGACCGG - Intronic
962290468 3:134132098-134132120 GGGACCCCGAATGGAGGGACCGG - Intronic
963349786 3:144138246-144138268 GGGACCCCGAATGGAGGGACTGG - Intergenic
970058028 4:11997277-11997299 GGGACCCTGAATGGAGGGACCGG - Intergenic
970448559 4:16144669-16144691 GGGACCCCGAATGGAGGGACCGG + Intergenic
972362443 4:38339689-38339711 GGGACCCCGAATGGAGGGACTGG - Intergenic
972940644 4:44191023-44191045 GGGACCCTGAATGGAGGGACCGG + Intronic
974961157 4:68702781-68702803 GGGACCCTGAATGGAGGGACTGG + Intergenic
974999115 4:69198226-69198248 GGGACCCTGAATGGAGGGACTGG + Intronic
975016354 4:69425423-69425445 GGGACCCCGAATGGAGGGACTGG - Intergenic
975307745 4:72868286-72868308 GGGACCCCGAATGGAGGGACTGG - Intergenic
976645569 4:87384121-87384143 GGGACCCCGAATGGAGGGACCGG + Intronic
976693113 4:87889891-87889913 GTGACCCCGAATGGAGGGACTGG - Intergenic
976971076 4:91103538-91103560 GGGACCCCGAATGGAGGGACTGG + Intronic
977720280 4:100231572-100231594 GGGACCCCGAATGGAGGGACCGG - Intergenic
978036636 4:104003064-104003086 GGGACCCCGAACGGGGGGACCGG - Intergenic
978573813 4:110168710-110168732 GAGACCCAGACTCTGTGGACAGG + Intronic
980046711 4:127997240-127997262 GGGACCCTGAATGGAGGGACCGG - Intronic
983189542 4:164740394-164740416 GGGACCCTGAATGGAGGGACTGG + Intergenic
987571992 5:19675939-19675961 GGGACCCCGAATGGAGGGACAGG - Intronic
988240233 5:28598970-28598992 GGGACCCTGAATGGAGGGACTGG + Intergenic
989317816 5:40102924-40102946 GGGACCCTGAATGGAGGGACCGG + Intergenic
992009015 5:72508979-72509001 GAGAGCCGGGATCAGGAGACAGG - Intergenic
993367304 5:87049792-87049814 GGGACCCTGAATAGAGGGACTGG - Intergenic
994615489 5:102099471-102099493 GGGACCCCGAATAGAGGGACCGG - Intergenic
996097412 5:119413560-119413582 GGGACCCCGAATGGAGGGACTGG + Intergenic
997115664 5:131123236-131123258 GGGACCCCGAATGGAGGGACCGG + Intergenic
999093299 5:148956356-148956378 GGGACCCCGAATGGAGGGACTGG - Intronic
1001984533 5:176061856-176061878 GAGACCTGGAAGCCGGGGACAGG + Exonic
1002232981 5:177782341-177782363 GAGACCTGGAAGCCGGGGACAGG - Exonic
1002263012 5:178007478-178007500 GAGACCTGGAAGCCGGGGACAGG + Intronic
1002645138 5:180649215-180649237 GAGACGCGGATTCAGGGGCCGGG + Intronic
1005978864 6:30820665-30820687 GAGAGCAGGAGTCGAGGGACGGG + Intergenic
1006286724 6:33101808-33101830 GGGACCCTGAATGGAGGGACCGG - Intergenic
1007685478 6:43664982-43665004 CACACCCTGAATCAGGGGACAGG - Intronic
1009245832 6:61236640-61236662 GGGACCCGGAACAGAGGGACCGG + Intergenic
1010810533 6:80294148-80294170 GGGACCCCGAATGGAGGGACCGG + Intronic
1011329670 6:86189764-86189786 GAGACCAGGATTGGTGGGACAGG - Intergenic
1011357592 6:86488637-86488659 GGGACCCTGAATGGAGGGACTGG + Intergenic
1012903950 6:105042204-105042226 GAGACACTGAATTGGGGGAAGGG + Intronic
1013833126 6:114298641-114298663 GGGACCCCGAATGGGGGGACCGG + Intronic
1013927809 6:115494174-115494196 GGGACCCTGAATGGAGGGACTGG - Intergenic
1014119963 6:117713262-117713284 GGGACCCCGAATGGAGGGACCGG - Intergenic
1018959833 6:168440699-168440721 GAACCCCGGAGTCTGGGGACCGG + Intergenic
1019072153 6:169355757-169355779 GGGACCCCGAATGGAGGGACTGG - Intergenic
1021020135 7:15587550-15587572 GGGACCCCGAATGGAGGGACTGG - Intergenic
1021706715 7:23374941-23374963 GGGACCCTGAACGGGGGGACCGG - Intronic
1025734690 7:64136577-64136599 GGGACCCTGAATGGAGGGACCGG + Intronic
1027566540 7:79801610-79801632 GGGACCCGGAACAGAGGGACTGG + Intergenic
1028450298 7:90974496-90974518 GAGACCCAGAACAGAGGGACTGG - Intronic
1029490585 7:100867991-100868013 GAGACCCGGGATCGTGGGGTGGG + Intronic
1029677347 7:102079583-102079605 GAGACCTGGAATACGTGGACTGG - Intronic
1030411293 7:109183246-109183268 GAGACCCCGAAAGGAGGGACTGG - Intergenic
1031838174 7:126704114-126704136 GGGACCCCGAATGGAGGGACTGG + Intronic
1032003347 7:128281123-128281145 GGGACCCCGAATGGAGGGACTGG - Intergenic
1034366961 7:150559417-150559439 GGGACCCCGAATGGAGGGACCGG + Intergenic
1035279922 7:157771368-157771390 GAGACAGGGAATGGGGGGGCAGG - Intronic
1037204187 8:16294257-16294279 GGGACCCCGAATGGAGGGACTGG + Intronic
1037327033 8:17702838-17702860 GGGACCCCGAATGGAGGGACCGG + Intronic
1038197256 8:25379756-25379778 GGGACCCCGAATGGAGGGACCGG - Intronic
1039185510 8:34911284-34911306 GGGACCCTGAATGGAGGGACTGG - Intergenic
1039580337 8:38660920-38660942 GAGACCCTGAATGGAGGAACTGG + Intergenic
1039669262 8:39578421-39578443 GGGACCCTGAATGGAGGGACTGG + Intergenic
1040583726 8:48719954-48719976 GGGACCCCGAATGGAGGGACCGG + Intronic
1041287425 8:56274730-56274752 GGGACCCCGAATAGAGGGACCGG + Intergenic
1041489108 8:58411605-58411627 AAGACCCGACATCGGGAGACCGG - Intronic
1042197695 8:66247196-66247218 GGGACCCCGAATGGAGGGACCGG + Intergenic
1042991708 8:74647691-74647713 GGGACCCAGAATGGAGGGACCGG + Intronic
1044039147 8:87343485-87343507 GGGACCCCGAATGGAGGGACCGG - Intronic
1044064085 8:87677333-87677355 GGGACCCAGAATGGAGGGACTGG - Intergenic
1044064734 8:87685476-87685498 GAGACCCCGAACGGAGGGACTGG + Intergenic
1044182249 8:89210590-89210612 GTGACCCCGAATGGAGGGACTGG + Intergenic
1044307864 8:90658331-90658353 GGGACCCTGAATGGAGGGACTGG - Intronic
1045593591 8:103627648-103627670 GGGACCCTGAATGGAGGGACCGG - Intronic
1046282636 8:112053751-112053773 GGGACCCTGAATGGAGGGACTGG - Intergenic
1049211433 8:141388245-141388267 GAGGCCAGGACTCGGGGGATTGG - Intergenic
1051658232 9:19402934-19402956 GGGACCCCGAATAGAGGGACTGG + Intergenic
1052687088 9:31770552-31770574 GGGACCCCGAATGGAGGGACTGG + Intergenic
1052777218 9:32744003-32744025 GGGACCCCGAATGGAGGGACTGG - Intergenic
1055343891 9:75313903-75313925 GAGATCCTGAATGGAGGGACTGG - Intergenic
1055908114 9:81317011-81317033 GGGACCCCGAATGGAGGGACTGG - Intergenic
1057180951 9:93029999-93030021 GAGTCCCGGGAGAGGGGGACAGG + Intronic
1057890696 9:98867681-98867703 GAGGCCAGGAATGGGGGGAGGGG + Intergenic
1058225400 9:102355618-102355640 GGGACCCAGAATGGAGGGACTGG + Intergenic
1059346773 9:113634414-113634436 GGGACCCTGACTCAGGGGACAGG + Intergenic
1060758790 9:126231732-126231754 GAGCCCCAGAAGCAGGGGACGGG + Intergenic
1203486943 Un_GL000224v1:64970-64992 GAGACCCCGAATGGAGGGACTGG - Intergenic
1203499563 Un_KI270741v1:6870-6892 GAGACCCCGAATGGAGGGACTGG - Intergenic
1187685184 X:21808925-21808947 GGGACCCTGAATGGAGGGACTGG - Intergenic
1188255703 X:27960034-27960056 GAGACCCTGAATGGAGAGACTGG + Intergenic
1188823505 X:34802404-34802426 GGGACCCTGAATGGAGGGACCGG + Intergenic
1188849460 X:35114108-35114130 GGGACCCTGAACGGGGGGACCGG + Intergenic
1189690926 X:43616208-43616230 GAGAGCAGGAGTCGGGGGAAGGG + Intergenic
1190185727 X:48232216-48232238 GGGACCCTGAATGGAGGGACTGG + Intronic
1192842552 X:74872167-74872189 GGGACCCTGAACGGGGGGACCGG - Intronic
1194071043 X:89326876-89326898 GGGACCCCGAATGGAGGGACCGG + Intergenic
1196597882 X:117566044-117566066 GGGACCCTGAATGGAGGGACTGG - Intergenic
1197071605 X:122305633-122305655 GGGACCCCGAATGGAGGGACCGG + Intergenic
1197267037 X:124385838-124385860 CAGACCCTGCATCTGGGGACAGG - Exonic
1198824238 X:140682507-140682529 GGGACCCTGAATGGAGGGACCGG + Intergenic
1199107617 X:143889513-143889535 GGGACCCCGAATGGAGGGACAGG + Intergenic
1199477070 X:148257587-148257609 GGGACCCCGAATGGAGGGACTGG - Intergenic
1199536528 X:148908451-148908473 GGGACCCCGAATGGAGGGACCGG - Intronic
1199989412 X:152977283-152977305 GAGACCCTGAACGGAGGGACTGG - Intergenic
1200725272 Y:6662621-6662643 GGGACCCAGAATGGAGGGACCGG + Intergenic
1201860394 Y:18591417-18591439 GGGACCCTGAATGGAGGGACTGG + Intergenic
1201872929 Y:18728964-18728986 GGGACCCTGAATGGAGGGACTGG - Intergenic
1201892552 Y:18958500-18958522 GGAACCCGGAATGGAGGGACTGG + Intergenic