ID: 1104894467

View in Genome Browser
Species Human (GRCh38)
Location 12:132155036-132155058
Sequence GGAGACCCGGAATCGGGGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 175}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894467_1104894477 3 Left 1104894467 12:132155036-132155058 CCGTCCCCCGATTCCGGGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894467_1104894474 -4 Left 1104894467 12:132155036-132155058 CCGTCCCCCGATTCCGGGTCTCC 0: 1
1: 0
2: 1
3: 13
4: 175
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894467 Original CRISPR GGAGACCCGGAATCGGGGGA CGG (reversed) Intergenic
900342395 1:2195095-2195117 GCAGAGCCGGAAACGGGGGCGGG - Intronic
903969427 1:27109286-27109308 GGGGTCCAGGAATCGGGAGAGGG - Intronic
906308677 1:44738058-44738080 GGAGACCGGGGAGAGGGGGAGGG - Intergenic
907523543 1:55040317-55040339 GGAGACCCGGAGGCCGAGGAAGG + Intronic
910987420 1:93019176-93019198 GGAGACTCAGAAGCGAGGGATGG + Intergenic
918794461 1:188874581-188874603 GGGGAGCCGGAAGAGGGGGATGG + Intergenic
920144070 1:203842591-203842613 GGAGACCGGGGAGAGGGGGAGGG + Intronic
920260304 1:204684455-204684477 GGAGACCCGGAACCTGGGGAGGG - Intronic
921486792 1:215724447-215724469 GGAGACTCGGAAGGGTGGGAGGG + Intronic
922586531 1:226738036-226738058 GGAGACCCGGAGACGGTGGCTGG - Intronic
922982623 1:229840639-229840661 GGAGACTCGGAAGGGTGGGAGGG + Intergenic
1063664571 10:8053664-8053686 GGAGACCCGCGAGCCGGGGAAGG + Intronic
1064722091 10:18239310-18239332 GGAGACTCGGAAAGGTGGGAGGG - Intronic
1064956915 10:20921543-20921565 GGAGAACTGGAATTGTGGGAGGG - Intronic
1067551797 10:47241580-47241602 AGAGACATGGAGTCGGGGGAAGG + Intergenic
1072610527 10:97014527-97014549 GGAGAGCGGGAATGGGAGGAAGG + Intronic
1073575389 10:104618587-104618609 GGAGGCAGGGAATCAGGGGAAGG - Intergenic
1074384755 10:113007836-113007858 CAAGTCCCGGAATCGGGGCAAGG - Intronic
1075748238 10:124743202-124743224 GGACACCCAGAATCCGGGGAGGG - Intronic
1076467897 10:130697581-130697603 GGAGACCCGATGTCTGGGGAAGG + Intergenic
1076552247 10:131288822-131288844 GGACACCAGGAGCCGGGGGAGGG + Intronic
1076633649 10:131868593-131868615 AGAACCCCGGAATCTGGGGAGGG - Intergenic
1077394232 11:2313291-2313313 GTTGACCCGGAAATGGGGGATGG - Intronic
1078749785 11:14150309-14150331 GGAGACTGGGAGTCAGGGGATGG + Intronic
1084062925 11:66687581-66687603 GCAGACCCGGACTCGGGGCCCGG - Exonic
1084197308 11:67530718-67530740 GGAGACCCGGACTGGGGGCCAGG + Intergenic
1084726279 11:70944357-70944379 GAAGACCTGGACTCCGGGGAGGG - Intronic
1090084997 11:123642804-123642826 GGAGACCCAGAATGTGGGGGTGG + Intronic
1090880869 11:130830554-130830576 GGTGACCCGGAAAGGGGTGAAGG - Intergenic
1091647614 12:2285668-2285690 GGAGACCAGGGAACGGTGGAAGG - Intronic
1096503927 12:52081262-52081284 GGGGCTCCAGAATCGGGGGAGGG - Intergenic
1097089933 12:56496982-56497004 GCAGACCGGGAAGCGGGGGGGGG + Intergenic
1098170499 12:67742205-67742227 ACAGACCAGGAAGCGGGGGATGG - Intergenic
1099367778 12:81790561-81790583 GGAGGCCTTGAGTCGGGGGAGGG + Intergenic
1099470528 12:83042567-83042589 AGAGAGAAGGAATCGGGGGAGGG - Intronic
1102518127 12:113463614-113463636 GGGGACCCGGGACCCGGGGAGGG + Intronic
1102755524 12:115336406-115336428 GGAGACCACTAAACGGGGGAGGG - Intergenic
1103245118 12:119450247-119450269 GGAGACCAGGAAGGGTGGGAGGG + Intronic
1104894467 12:132155036-132155058 GGAGACCCGGAATCGGGGGACGG - Intergenic
1105019974 12:132809442-132809464 GCAGACCGGGAACCGGGGGGCGG - Intronic
1110779738 13:79451030-79451052 GGAGACCTGGAAGGGTGGGAGGG + Intergenic
1112199288 13:97259537-97259559 GGAGCATCTGAATCGGGGGAAGG - Intronic
1113769481 13:112898978-112899000 GCAGACCCGGCATGGGGGGAGGG - Intronic
1114271324 14:21102048-21102070 GGAGACCCTGAATGGTGAGAAGG - Exonic
1114992626 14:28306502-28306524 GGAGACTCGGAAGTGTGGGAAGG - Intergenic
1118809350 14:69261735-69261757 GGGGACTCGGAATCTGGGGCAGG - Intronic
1119386834 14:74262517-74262539 GAAGAACCGGACTAGGGGGAGGG - Exonic
1119516728 14:75254349-75254371 TGAGATCCGGGATCAGGGGATGG - Intronic
1120211900 14:81641683-81641705 GGCGAGCCAGAAGCGGGGGATGG + Intergenic
1120870466 14:89332397-89332419 GGAGACCGGGGATGGGGGTAAGG - Intronic
1122936101 14:104957037-104957059 GGAGACAAGGACTCGGGGAAGGG - Intronic
1123126644 14:105951725-105951747 GGAGAACCAGAGTCAGGGGAAGG + Intergenic
1123407154 15:20027826-20027848 GGAGAGCCAGAGTCAGGGGAAGG + Intergenic
1123516484 15:21034482-21034504 GGAGAGCCAGAGTCAGGGGAAGG + Intergenic
1124245636 15:28069428-28069450 GGAGACCGGGGAGAGGGGGAGGG - Intronic
1129323823 15:74789205-74789227 GGAGCCCCGGGATGGGGGTAGGG + Intronic
1131346716 15:91656376-91656398 GGAGGCAGGGAAGCGGGGGAGGG - Intergenic
1132309953 15:100849976-100849998 GGGGACCCGGGAGCGGGGGGCGG + Intergenic
1132627489 16:898476-898498 GGACACCCAGAGCCGGGGGAAGG - Intronic
1132868268 16:2104337-2104359 GGAGAATGGGAATTGGGGGAGGG + Intronic
1133591233 16:7246308-7246330 GGAGACAGGGAATCCAGGGAGGG - Intronic
1134523498 16:14928760-14928782 GGAGAATGGGAATTGGGGGAGGG - Intronic
1134549394 16:15132160-15132182 GGAGAATGGGAATTGGGGGAGGG + Intronic
1134711092 16:16327244-16327266 GGAGAATGGGAATTGGGGGAGGG - Intergenic
1134948482 16:18341339-18341361 GGAGAATGGGAATTGGGGGAGGG + Intergenic
1136451855 16:30358192-30358214 GGAGACCCGGAAGCAGGAGAAGG - Exonic
1142400944 16:89858534-89858556 AGAGACCAGGAATGGGAGGATGG + Intronic
1146791357 17:35752557-35752579 GGAGACCCCGACCCGGGGCATGG + Exonic
1147149208 17:38504347-38504369 GGAGACCAGGAATCGGAGTCAGG + Intronic
1148808117 17:50274368-50274390 GGAGAGGCGGACTCGGGGCAGGG - Intronic
1150634563 17:66903924-66903946 GGACACCAGGAATCGGCGGGCGG - Intergenic
1152861495 17:82698891-82698913 GGAGGCCCGGAGACGGGGCAGGG + Intergenic
1153722137 18:7916086-7916108 GGAGACCCTGAAAGGTGGGACGG + Intronic
1154385087 18:13886063-13886085 GGAGACTCGGAAGGGTGGGAGGG + Intronic
1155800944 18:30102526-30102548 GGGGAGCCGGAATAGGGGGATGG - Intergenic
1156590546 18:38482912-38482934 GGAGACCGGGAATGGATGGAGGG + Intergenic
1157494478 18:48145434-48145456 TGAGACCCGCAATCAGGGCAGGG - Intronic
1157553416 18:48597025-48597047 GGAGACCAGGAATTTGGGGCAGG - Intronic
1158269456 18:55697140-55697162 GGACAACTGGAAACGGGGGAAGG + Intergenic
1160513683 18:79466792-79466814 GGAGACGCGGTCTCTGGGGAGGG - Intronic
1160857346 19:1223488-1223510 GGAGCCCCAGGGTCGGGGGAGGG + Intronic
1160883139 19:1331636-1331658 GGGGAACTGGAACCGGGGGAGGG - Intergenic
1160911085 19:1474110-1474132 GGGGCCCCGGAAGCTGGGGAGGG - Exonic
1160965648 19:1745975-1745997 GGAGACTAGGAATGGGAGGAGGG + Intergenic
1162204563 19:9046105-9046127 GGAGAGAAGGAATCTGGGGAGGG - Intergenic
1162379515 19:10323256-10323278 GCAGGCCCTCAATCGGGGGAAGG - Exonic
1162549566 19:11351048-11351070 GGAGACCCAGAACTGGGGAATGG + Intronic
1163243343 19:16077159-16077181 GGGGACCGGGGATCTGGGGAGGG + Intronic
1166218687 19:41352387-41352409 GGAGACAAGCAATAGGGGGAGGG - Intronic
1166543825 19:43622727-43622749 GGAGCCCAGGAACCTGGGGAAGG + Exonic
925070011 2:959494-959516 GGAGGCCTGGAGTCGGGGGGAGG + Intronic
926310179 2:11669473-11669495 GGAGAGCGGGAGTCGGGGGAGGG - Intronic
927912859 2:26914029-26914051 GGAGACCCTGAAGCCAGGGAGGG + Intronic
928983296 2:37157192-37157214 GGAGCCCCGGGGGCGGGGGATGG - Intergenic
932329163 2:70887858-70887880 GGAGACGCGGAAGCCGGGTAGGG - Intergenic
937238181 2:120443038-120443060 GGAGAGCAGGAAACTGGGGAGGG + Intergenic
941773178 2:169364298-169364320 GGAGAGCCGGGGTCTGGGGAGGG + Intergenic
942977789 2:182039807-182039829 GGAGACTCAGAATTGGGAGAGGG - Intronic
944280269 2:197887732-197887754 GGAGACTCGGAATGGTGGGAGGG - Intronic
944294201 2:198043593-198043615 GGAGACCCAGAATCAGGTGGAGG + Intronic
945497195 2:210523497-210523519 GGAGACTCGGAAAGGTGGGAGGG - Intronic
946167864 2:217876323-217876345 GGGGACCTGGAATCTGGGCACGG + Intronic
946538432 2:220657563-220657585 GGGGAGCCGGAAGTGGGGGATGG + Intergenic
948492333 2:238321134-238321156 GGCGGCCCGGAGCCGGGGGAGGG - Intronic
948916728 2:241038070-241038092 GGAGAGCAGGAATTGGGGGGGGG - Intronic
948949331 2:241238911-241238933 GGAGCCCTGGACTCGGGAGAAGG - Intronic
1169978119 20:11353383-11353405 GGAGATCTGGAAGTGGGGGATGG - Intergenic
1170312967 20:15012724-15012746 GGAGACCGGGAAATGGGGTAGGG - Intronic
1172023966 20:31935507-31935529 GGTGACCCTGAATAGGGGGTTGG - Intronic
1174036092 20:47669212-47669234 GGGGACGAGGACTCGGGGGATGG - Intronic
1175238178 20:57526851-57526873 GGAGACCTGGGGTCGGGGGGAGG + Intergenic
1175871870 20:62212972-62212994 GGAGAGCGGGGATGGGGGGAGGG + Intergenic
1179553996 21:42160773-42160795 GGAGACCTGAAAACGGGGGTTGG - Intergenic
1180118912 21:45732971-45732993 GGAGACCCAGAAGCAGGGGATGG - Intronic
1181412623 22:22734811-22734833 GGAGACCCGGACACGGAGGGAGG - Intronic
1181424302 22:22823011-22823033 GGAGACCCGGACGCGGAGGGAGG - Intronic
1181428092 22:22856781-22856803 GGAGACCCGGACACGGAGGGAGG - Intronic
1181563105 22:23717067-23717089 GGAGGCGCGGACTCGGGGCAGGG - Intergenic
1184294373 22:43514702-43514724 GGAGTCAGGGAATCGGGGGGCGG - Intergenic
1184854441 22:47138764-47138786 GCAGACCCGGCATCTGGTGAGGG + Intronic
1185076146 22:48683878-48683900 GGAGAGCCGGCAACGGGGGAGGG - Intronic
1185270270 22:49926674-49926696 GGGGACCCGGGGTGGGGGGAGGG - Intronic
1185270299 22:49926728-49926750 GGGGACCCGGGGTGGGGGGAGGG - Intronic
1185270317 22:49926761-49926783 GGGGACCCGGGGTGGGGGGAGGG - Intronic
1185270335 22:49926794-49926816 GGGGACCCGGGGTGGGGGGAGGG - Intronic
1185333044 22:50260207-50260229 GGTGGCCAGGAACCGGGGGACGG + Intronic
951078622 3:18425479-18425501 GGAGGGCCGGGATTGGGGGAGGG + Intronic
951728137 3:25782973-25782995 GGAGTCCCGGAAGCGGGGCCGGG - Intronic
956625944 3:71266724-71266746 GGAGACCCCAAAAAGGGGGAAGG - Intronic
957188791 3:76979369-76979391 GGAGACCTGGAAGAGTGGGAGGG - Intronic
959171704 3:102852139-102852161 GGAGAAAGGGAATGGGGGGAAGG - Intergenic
961502790 3:127349870-127349892 GGACACCCGCTGTCGGGGGAGGG - Intergenic
965065166 3:163839230-163839252 GGGGAGCCGGAAGCGGGGGATGG + Intergenic
967708245 3:192677322-192677344 TGAGATCAGGAATAGGGGGAAGG - Intronic
968016751 3:195341979-195342001 GGAGACTCAGAAAGGGGGGAAGG + Intronic
968309235 3:197669134-197669156 GGAGAGCTGAAATCGGGTGAGGG - Intergenic
981018813 4:140003943-140003965 GGAGAGCAGGAATGGGAGGAAGG - Intronic
983904310 4:173168751-173168773 GGAGAGCCGGAGGAGGGGGAAGG + Exonic
985223452 4:187732604-187732626 GGAGCCACGGAAACAGGGGAAGG + Intergenic
985321856 4:188721627-188721649 GGAGAACAGGAAGAGGGGGAAGG + Intergenic
989375445 5:40755827-40755849 GGAAACCAGGAATCCAGGGAAGG - Exonic
991489296 5:67166738-67166760 GGAGACCCGGAAGGAGGGCAGGG - Exonic
991702627 5:69330616-69330638 GGAGACCTGGAATGGGGGCTGGG - Intronic
992951647 5:81863955-81863977 GGTGACCCACAAGCGGGGGAAGG - Intergenic
993710464 5:91219669-91219691 GGAAGCCAGGAATCTGGGGAAGG - Intergenic
1002190550 5:177475164-177475186 GGAGACCCTGCAGCCGGGGAGGG + Intergenic
1002645137 5:180649214-180649236 GGAGACGCGGATTCAGGGGCCGG + Intronic
1003256106 6:4476369-4476391 GGGGATGCGGAATTGGGGGAGGG - Intergenic
1003521804 6:6864440-6864462 GCAGACCTGGTATCCGGGGAGGG - Intergenic
1003550160 6:7096010-7096032 GGAGACCCAGAAGGGTGGGAGGG - Intergenic
1003569088 6:7244393-7244415 GGAGACCCTGACTCTAGGGAGGG + Intronic
1004343564 6:14828362-14828384 GTAGACACAGAATGGGGGGAGGG + Intergenic
1004799909 6:19134814-19134836 GGGGAGCCAGAACCGGGGGATGG - Intergenic
1005300380 6:24464791-24464813 GCAGCCCCCGAATCGGGGAAAGG - Intronic
1012903949 6:105042203-105042225 AGAGACACTGAATTGGGGGAAGG + Intronic
1012939699 6:105403312-105403334 GGGGACCCGGCCTCGGTGGAAGG - Intergenic
1018525997 6:164710518-164710540 GGGGAGCCGGAAGTGGGGGATGG + Intergenic
1019279438 7:192674-192696 GGAGACCGGGGCTGGGGGGAAGG - Intergenic
1020849963 7:13340536-13340558 GGAGACTCGGAACGGGGAGATGG - Intergenic
1021146861 7:17099817-17099839 GGATTCCCGGAATCTGGGCATGG - Intergenic
1021733306 7:23618350-23618372 GAAGACCCAGAATGGGGGGTTGG - Intronic
1024829383 7:53431108-53431130 GGAGACTCAGACTGGGGGGAAGG + Intergenic
1029490584 7:100867990-100868012 TGAGACCCGGGATCGTGGGGTGG + Intronic
1033243719 7:139701825-139701847 GGAGGCCTGGAGGCGGGGGAAGG + Intronic
1034174664 7:149090963-149090985 GGATTCCCGGGATCTGGGGAGGG + Intergenic
1034552361 7:151829795-151829817 GGGGACCCTGCAGCGGGGGAGGG + Intronic
1035735911 8:1887508-1887530 GGAGACCCTGAGTGGGGTGAGGG + Intronic
1035735948 8:1887749-1887771 GGAGACACGGAGTGGGGTGAGGG + Intronic
1035736207 8:1889205-1889227 GGAGACACTGAATGGGGTGAGGG + Intronic
1035736376 8:1890182-1890204 GGAGACACTGAATAGGGTGAGGG + Intronic
1035736410 8:1890385-1890407 GGAGACACTGAATTGGGTGAGGG + Intronic
1040017755 8:42713675-42713697 GGAGACTCGGAAGAGTGGGAGGG - Intronic
1045254470 8:100508166-100508188 GCAGCCACGGAATCGGGGGCTGG + Intergenic
1048899888 8:139027271-139027293 GGGGAGCCGGAAGCGGGGGATGG - Intergenic
1055083185 9:72288284-72288306 GGAGACTCGGAATGGTGGGAGGG + Intergenic
1055538835 9:77279245-77279267 GGAGAGCCGGAAGTGGGGGATGG + Intronic
1057890695 9:98867680-98867702 GGAGGCCAGGAATGGGGGGAGGG + Intergenic
1060560696 9:124540304-124540326 AGAGGCCCGGAATATGGGGATGG - Intronic
1203772458 EBV:56505-56527 GGAGATCAGGAGGCGGGGGAAGG - Intergenic
1185464429 X:346321-346343 GGAGACCGGGAGCCGGGAGAGGG + Intronic
1186670015 X:11758403-11758425 GGGGACCCGGGACCGGGGGCGGG + Intronic
1187984617 X:24796867-24796889 TGAGACCGGGAATCAGGGAAGGG - Intronic
1188712756 X:33421844-33421866 GGAGACTCGGAAATGTGGGAGGG + Intergenic
1188907457 X:35805538-35805560 GGATACCCTAAGTCGGGGGAAGG - Intergenic
1189690925 X:43616207-43616229 AGAGAGCAGGAGTCGGGGGAAGG + Intergenic
1196893433 X:120311138-120311160 GGAGAGCGGGAAACGGGGCATGG - Intronic
1198600959 X:138283431-138283453 GGAGACCGGGGAGAGGGGGAGGG + Intergenic
1200291912 X:154883606-154883628 AGTGACCCGGCATCTGGGGACGG + Intronic
1200338750 X:155379343-155379365 AGTGACCCGGCATCTGGGGACGG + Intergenic
1200347719 X:155461349-155461371 AGTGACCCGGCATCTGGGGACGG - Intergenic