ID: 1104894468

View in Genome Browser
Species Human (GRCh38)
Location 12:132155040-132155062
Sequence GAAGGGAGACCCGGAATCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894468_1104894477 -1 Left 1104894468 12:132155040-132155062 CCCCCGATTCCGGGTCTCCCTTC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894468_1104894474 -8 Left 1104894468 12:132155040-132155062 CCCCCGATTCCGGGTCTCCCTTC 0: 1
1: 0
2: 0
3: 2
4: 99
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894468 Original CRISPR GAAGGGAGACCCGGAATCGG GGG (reversed) Intergenic
902090933 1:13902541-13902563 GAAGGGAGACAGGGAAGAGGGGG + Intergenic
904500801 1:30911744-30911766 GAAGGGAGACCCTGAGTATGTGG - Intergenic
906203062 1:43972146-43972168 GAAGGGAGAGCCTGAAAGGGAGG - Exonic
906943668 1:50277341-50277363 GAAGGGAAACCCAGATTCAGAGG - Intergenic
907450344 1:54542261-54542283 GAAGGGAGGCGCGGAGGCGGCGG - Intronic
909632911 1:77785936-77785958 GAAGGGAAACATGGAGTCGGAGG - Intronic
910290296 1:85594102-85594124 GAAGGGAGAACAGGTATTGGGGG + Intergenic
916075554 1:161198210-161198232 CAATGGAGATCCGGAGTCGGTGG - Exonic
1069403950 10:68077994-68078016 GAAGGGAGAGCATGAATTGGTGG + Intergenic
1070091650 10:73291849-73291871 GAAGGGAGATGAGGAATCAGTGG - Intronic
1072610526 10:97014523-97014545 CAAGGGAGAGCGGGAATGGGAGG + Intronic
1075995598 10:126873875-126873897 GGAGGGAGCCCCGGAAAGGGTGG - Intergenic
1076162379 10:128255304-128255326 GAAGGGAGCCCAGGATTCAGGGG - Intergenic
1079203463 11:18394578-18394600 GCAATGAGATCCGGAATCGGCGG - Intronic
1084285603 11:68128626-68128648 GCAGGGAGGCCCGCAGTCGGTGG - Intergenic
1088470228 11:110182198-110182220 CAAGGGAGACGCGGAAGAGGTGG + Intronic
1099738758 12:86602674-86602696 TAAGGGAGACCTCGAATCAGAGG - Intronic
1104894468 12:132155040-132155062 GAAGGGAGACCCGGAATCGGGGG - Intergenic
1105571215 13:21604302-21604324 GAAGGCAGCCCCGGAACCGAAGG - Intergenic
1105825223 13:24116385-24116407 GACGGGAGACACAGAATTGGGGG + Intronic
1110584553 13:77173076-77173098 GAAGAGAGACCCGGAGTCCAGGG + Intronic
1113779626 13:112968808-112968830 GCGTGGAGACCCGGAACCGGGGG + Intronic
1113937183 13:114000663-114000685 GAAGGGAGAACCAGAAGCAGAGG + Intronic
1132983857 16:2753246-2753268 GAAAGGAGATCTGGAACCGGGGG - Intronic
1141915548 16:87094067-87094089 GCAGGGAGACCCGGGATGGTTGG + Intronic
1142173456 16:88634525-88634547 GGAGGGCGACCCGGAGGCGGAGG - Intergenic
1142400943 16:89858530-89858552 GAAAAGAGACCAGGAATGGGAGG + Intronic
1143096958 17:4483271-4483293 GAAGGGAGAGCCAGAAACAGAGG + Intronic
1149481085 17:57003647-57003669 GAAGGGAGACCAGGGATGCGTGG + Intronic
1152287684 17:79422178-79422200 GAAGGGAGACAGGGAAACAGGGG + Intronic
1154001281 18:10484260-10484282 GAAGGGAGAGCTGGAAGCTGCGG - Intronic
1155347835 18:24876168-24876190 AAAGGGACACCCTGAATGGGTGG - Intergenic
1157584886 18:48794582-48794604 GAAGGGAAACTTGGAATCAGAGG + Intronic
1160965646 19:1745971-1745993 GGAGGGAGACTAGGAATGGGAGG + Intergenic
1161808757 19:6459646-6459668 GAGGGGAGGCCCGGCAGCGGCGG + Exonic
1162867451 19:13559571-13559593 GAAGTGAGACAAGGAATCGAAGG + Intronic
1167485090 19:49758134-49758156 GAAGGGAGACCAGGGAGAGGGGG - Intronic
1168239934 19:55083864-55083886 GAATGGAGACCCGGATTCCTGGG + Intronic
928985104 2:37173290-37173312 CAAAGGAGACCAGGAAGCGGGGG - Intronic
932341493 2:70965163-70965185 GAGGGGAGACCCGGGAGCCGAGG - Exonic
936078581 2:109417371-109417393 GAAGGGAGACAGGGAAGAGGAGG - Intronic
948028789 2:234799849-234799871 GAAGGGAGAGCAGGCATTGGGGG - Intergenic
1169061513 20:2663829-2663851 GTAGGGAGACCCGGGAGGGGTGG + Intronic
1171087565 20:22252141-22252163 GAAGGAAGACCAGGACACGGGGG - Intergenic
1172481927 20:35276570-35276592 GAAGGGAGGCCAGGAAGAGGTGG - Exonic
1175173286 20:57094239-57094261 AAAGGGAGGCCTGGAATCAGGGG + Intergenic
1175871983 20:62213240-62213262 GAAGGGAGAGCAGGGATGGGGGG + Intergenic
1175872074 20:62213460-62213482 GAAGGGAGAGCAGGGATGGGGGG + Intergenic
1175872108 20:62213545-62213567 GAAGGGAGAGCAGGGATGGGGGG + Intergenic
1175872145 20:62213632-62213654 GAAGGGAGAGCAGGGATGGGGGG + Intergenic
1175872182 20:62213719-62213741 GAAGGGAGAGCAGGGATGGGGGG + Intergenic
1176109364 20:63404476-63404498 GAAGGGAGACCTGGCAGTGGAGG - Intergenic
1182586252 22:31345864-31345886 GAAGGTAGACCGGGAAGGGGAGG - Exonic
1182662164 22:31932960-31932982 GGAGGGAGACCAGGAAGGGGCGG + Intergenic
1184158040 22:42681732-42681754 GAAGGGAGAGCCGGGCACGGTGG - Intergenic
1185076148 22:48683882-48683904 GGAGGGAGAGCCGGCAACGGGGG - Intronic
1185131872 22:49043841-49043863 GCAGGCAGACCCGAAAACGGGGG + Intergenic
1185168413 22:49276613-49276635 GAAGGAAGACCCTGGATGGGTGG - Intergenic
949614634 3:5739659-5739681 GAAGGGAGACAGGGAAGGGGAGG - Intergenic
952676163 3:36032649-36032671 GAACAGAGACCCGGAATCCCTGG - Intergenic
953033759 3:39193909-39193931 GGAGGGAGACCAGGAAGAGGGGG - Intergenic
954197996 3:49007664-49007686 GAAGGGAGCCCCGGAGATGGCGG + Intronic
958553291 3:95643414-95643436 GAAGGGAAACGTGGGATCGGAGG - Intergenic
964432352 3:156620741-156620763 GATGGCTGACCCAGAATCGGTGG - Intergenic
964893110 3:161560201-161560223 GATGGGAGGCTCTGAATCGGGGG - Intergenic
969716661 4:8871297-8871319 GAAGGGCGGCCCGGGACCGGGGG + Exonic
980856797 4:138450471-138450493 TAAGGTAGCCCCGGAATTGGGGG + Intergenic
995719155 5:115111556-115111578 GAAGGGGGAGCCAGAATAGGAGG - Intergenic
997350834 5:133230328-133230350 CAAGGGAGACCCTGAGTCAGTGG + Intronic
999125551 5:149243448-149243470 AAAAGGAGGCCCAGAATCGGTGG + Intronic
1001456403 5:171863936-171863958 CAAAGGAGAGCCGGAATCAGAGG + Exonic
1003256108 6:4476373-4476395 GAAGGGGGATGCGGAATTGGGGG - Intergenic
1006305042 6:33213672-33213694 GAAGGGAGCCATGGGATCGGCGG - Intergenic
1008945305 6:57090253-57090275 CATGGGAGACCCGGGGTCGGAGG + Exonic
1018200772 6:161393034-161393056 GTAGAGAGACCCGGAGTCTGAGG + Intronic
1019220376 6:170468432-170468454 GAACAGAAACCCTGAATCGGAGG + Intergenic
1021809955 7:24393372-24393394 GAAGGGAAACCGGGAATCTTTGG - Intergenic
1028054524 7:86225884-86225906 GAGGGGAGACCTGGAATAGGAGG + Intergenic
1028160072 7:87475582-87475604 GAAGGGAGACCCGGGACGTGGGG - Intronic
1032016379 7:128382801-128382823 GAAGGGAGCCCAGGAAAGGGAGG + Intergenic
1033322464 7:140352251-140352273 GAAGGGAGACCGGGAAGCAAGGG + Intronic
1034262041 7:149763327-149763349 GAAGGGAGACTCGGTGTTGGGGG - Intergenic
1035076075 7:156178486-156178508 GAAGGGAGAGGCGGGATCGGGGG + Intergenic
1038443364 8:27586693-27586715 GAAGGGAGCCCCGGATTCCATGG + Intergenic
1044946696 8:97396239-97396261 GAAGAGAGAGCCGGAAACAGTGG - Intergenic
1047292183 8:123540770-123540792 GGAGGGAGACCCTGACCCGGAGG - Intronic
1049698743 8:143996956-143996978 GCAGGGAGACCCAGACTTGGGGG + Intronic
1049777422 8:144413163-144413185 GAGGGGAGACCTGGAACAGGTGG - Intronic
1053573285 9:39331898-39331920 GAAGGGAGTGCTGGAACCGGGGG + Intergenic
1053624642 9:39856130-39856152 GAAGGGAGTGCTGGAACCGGGGG + Intergenic
1053880228 9:42587098-42587120 GAAGGGAGTGCTGGAACCGGGGG - Intergenic
1053892436 9:42707228-42707250 GAAGGGAGTGCTGGAACCGGGGG + Intergenic
1054094855 9:60890604-60890626 GAAGGGAGTGCTGGAACCGGGGG + Intergenic
1054116322 9:61166508-61166530 GAAGGGAGTGCTGGAACCGGGGG + Intergenic
1054123859 9:61287113-61287135 GAAGGGAGTGCTGGAACCGGGGG - Intergenic
1054219254 9:62394568-62394590 GAAGGGAGTGCTGGAACCGGGGG - Intergenic
1054231460 9:62514605-62514627 GAAGGGAGTGCTGGAACCGGGGG + Intergenic
1056214949 9:84397942-84397964 GTTGGGAGCCCCGGAATCTGTGG + Intergenic
1056574580 9:87845338-87845360 GAACGGAGACCTGGACTCTGAGG + Intergenic
1062090664 9:134677090-134677112 GCAGGGACACCAGGAAGCGGCGG + Intronic
1186456789 X:9715923-9715945 GAAGGGACACCTGCAATCGTGGG - Intronic
1202019879 Y:20453103-20453125 GATGGGAGACCTGGAATCAAAGG + Intergenic