ID: 1104894469

View in Genome Browser
Species Human (GRCh38)
Location 12:132155041-132155063
Sequence TGAAGGGAGACCCGGAATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1104894469_1104894479 30 Left 1104894469 12:132155041-132155063 CCCCGATTCCGGGTCTCCCTTCA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1104894479 12:132155094-132155116 TCACAGCTACATCCGTAATGAGG 0: 1
1: 0
2: 0
3: 7
4: 44
1104894469_1104894477 -2 Left 1104894469 12:132155041-132155063 CCCCGATTCCGGGTCTCCCTTCA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG 0: 1
1: 0
2: 0
3: 10
4: 82
1104894469_1104894474 -9 Left 1104894469 12:132155041-132155063 CCCCGATTCCGGGTCTCCCTTCA 0: 1
1: 0
2: 0
3: 3
4: 73
Right 1104894474 12:132155055-132155077 CTCCCTTCAGGAAATGAACGCGG 0: 1
1: 0
2: 2
3: 5
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1104894469 Original CRISPR TGAAGGGAGACCCGGAATCG GGG (reversed) Intergenic
903959977 1:27050855-27050877 TTAAGAGAGACCCTGAATCAGGG - Intergenic
904945050 1:34193099-34193121 TGGAAGGAGACCCTGAATCAGGG + Intronic
905550167 1:38831151-38831173 AGAAGGGAGATGCCGAATCGAGG + Intergenic
906566767 1:46806486-46806508 TTAAGGGAGACCAGGGATCCTGG - Intronic
920067129 1:203276920-203276942 TGAAGGGTGACCCTGAATTGGGG - Intergenic
1065008733 10:21402915-21402937 TGAAGGGAGAACCAGAACCCTGG - Intergenic
1069706122 10:70459932-70459954 TGAAGGGTGACCGTGAAGCGGGG - Intergenic
1072067432 10:91884546-91884568 TGAAGGGAGACAAGGTATGGGGG - Intergenic
1072715243 10:97747760-97747782 TGAAGGGAAACCAGGAAACATGG - Intronic
1074891596 10:117740769-117740791 TGCAGGGAGACCCTGAAGCCAGG - Intergenic
1096510856 12:52127403-52127425 TGCAGAGAGACCAGGAATCTGGG + Intergenic
1104894469 12:132155041-132155063 TGAAGGGAGACCCGGAATCGGGG - Intergenic
1110584552 13:77173075-77173097 AGAAGAGAGACCCGGAGTCCAGG + Intronic
1117297537 14:54393456-54393478 TGGAGGGAGAGCGGGAATCGGGG + Intergenic
1117984951 14:61378134-61378156 GGAAGTGAGACCCTGAATTGAGG - Intronic
1120867591 14:89309130-89309152 TGAAGGGAGACCCTCAAACCTGG - Intronic
1121100104 14:91244665-91244687 TGGAGGGAGAGCTGGGATCGTGG - Intronic
1121466534 14:94119120-94119142 TGAAGGGAGACAGGGTATCCAGG - Intergenic
1127983776 15:64052623-64052645 TGAAGGGAGGCCAGGCATGGAGG + Intronic
1129323821 15:74789200-74789222 TGACGGGAGCCCCGGGATGGGGG + Intronic
1130792632 15:87171976-87171998 TGAAGGGAGACTGGGAATTCTGG + Intergenic
1140462634 16:75152897-75152919 TGAAGGCAGAACTGGAATAGAGG - Exonic
1156779031 18:40828183-40828205 TGAAGTGAGACCTAGAATCTGGG + Intergenic
1162549565 19:11351043-11351065 GGAAGGGAGACCCAGAACTGGGG + Intronic
1166541094 19:43606434-43606456 TGAAAGGAGGCCCGGCATGGTGG - Intronic
1168239933 19:55083863-55083885 GGAATGGAGACCCGGATTCCTGG + Intronic
926947079 2:18200052-18200074 TCAAGGGAGACCCAGAACAGCGG + Intronic
927251587 2:20999532-20999554 TGAAAGGAGGCCTGGAATTGTGG - Intergenic
929451547 2:42041507-42041529 TGAAAAAAGACCCTGAATCGGGG + Intergenic
939234013 2:139468032-139468054 TGAAGGGAGAGCAGTAGTCGTGG + Intergenic
942043830 2:172087726-172087748 TGAGGGGAGAACCGGGATCCAGG - Intronic
947824816 2:233098548-233098570 TGAGGGGAGAACCGGGATCCAGG - Intronic
948887434 2:240891289-240891311 TGATGAGAGACCTGGAATTGTGG - Intronic
1182321201 22:29479547-29479569 TGAAGGGGGACCTGGAGTTGGGG - Intergenic
1182786340 22:32910957-32910979 TGGAGGGAGAACCTGAATCCAGG + Intronic
952778721 3:37072211-37072233 TGAAGGGAGGCCAGGCATGGTGG + Intronic
954429966 3:50465408-50465430 TGCAGGGAGACCCGGAAGCTGGG - Intronic
954469876 3:50683949-50683971 TGGAGAGAGACCCGGCATGGTGG - Intronic
954990847 3:54839620-54839642 TAAAGGGAGCCCAGGAATCAGGG + Intronic
957911503 3:86624762-86624784 TGAAGGGAGACCCTACATCTAGG - Intergenic
959305755 3:104663907-104663929 TGAAGGGAGGCCAGGATTTGGGG + Intergenic
960512059 3:118561957-118561979 TGAAGAGAGAACCGGAAATGAGG + Intergenic
963259084 3:143176148-143176170 TGAAGGGAGACCTGGGATACCGG - Intergenic
968951870 4:3699661-3699683 TGGAGGCAGACACGGAGTCGCGG + Intergenic
972687346 4:41363523-41363545 TCAAGGAAGACCAAGAATCGAGG - Intronic
973783579 4:54314361-54314383 TTAAGGGAGAACCAGAATCTTGG - Intergenic
980856796 4:138450470-138450492 TTAAGGTAGCCCCGGAATTGGGG + Intergenic
990812693 5:59747060-59747082 TGAAGGGAGATCCAGAAACTGGG - Intronic
991733831 5:69613791-69613813 TGAATGGAGGCCCGGCATGGTGG + Intergenic
991810265 5:70468933-70468955 TGAATGGAGGCCCGGCATGGTGG + Intergenic
991860436 5:71008355-71008377 TGAATGGAGGCCCGGCATGGTGG - Intronic
996308342 5:122076848-122076870 TGAAGGTAGACCGGGGAGCGGGG + Intronic
1002388076 5:178885748-178885770 TGAAGTGAGATCCTGAATAGAGG + Intronic
1002915287 6:1523982-1524004 AGGAGGGAGACGCGGACTCGGGG - Intergenic
1003256109 6:4476374-4476396 TGAAGGGGGATGCGGAATTGGGG - Intergenic
1006187671 6:32190071-32190093 TGAAGGGAGACCTGGGATACCGG + Exonic
1006988697 6:38194612-38194634 TGAAGGCAGGCCCAGAATCACGG + Intronic
1007485463 6:42178144-42178166 TGAGGGGAGACCCGGACCCTCGG - Intronic
1013198085 6:107863724-107863746 TGAAGGGGGACCAGGCATGGTGG - Intergenic
1013734504 6:113209606-113209628 TGAAGGGTGACCCAGCATCTGGG + Intergenic
1018580899 6:165307836-165307858 TGAGGGGAGCCCAGGACTCGAGG - Intronic
1025942216 7:66082850-66082872 TGAAGGGAGACCCAGGGTCACGG - Intronic
1030197329 7:106865307-106865329 TGAAGGGAGCCCCAGAAAAGCGG + Intronic
1033282151 7:140013912-140013934 TGAAGTGAGGCCATGAATCGGGG - Intronic
1033322463 7:140352250-140352272 GGAAGGGAGACCGGGAAGCAAGG + Intronic
1035076074 7:156178485-156178507 AGAAGGGAGAGGCGGGATCGGGG + Intergenic
1038164577 8:25073080-25073102 TGAAGGGAGACAAGGAATTTGGG - Intergenic
1041811930 8:61921435-61921457 TGAAGGAAGACCAAGAATCAAGG - Intergenic
1044448168 8:92302409-92302431 TGGATGGAGAGCCGGAGTCGGGG + Intergenic
1054934189 9:70669196-70669218 TGAAGGAAGAACTGGAATCCAGG - Intronic
1056591350 9:87968309-87968331 TGAGGGGAGACCCAGATTCTGGG + Intronic
1059701126 9:116776027-116776049 TGAAGGGAGACTGGGTATTGAGG + Intronic
1060921381 9:127422926-127422948 TGAATGGATACCGGGAATCTAGG - Intergenic
1186456790 X:9715924-9715946 AGAAGGGACACCTGCAATCGTGG - Intronic
1198223903 X:134627894-134627916 TTAAGGGAGACCTGGATTTGAGG + Intronic
1199600028 X:149536401-149536423 TGAAGGGAAACCATGAATCAGGG + Intergenic
1199650554 X:149943539-149943561 TGAAGGGAAACCATGAATCAGGG - Intergenic